SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11270  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA012651
Annotation
PREDICTED:_uncharacterized_protein_LOC106139693_isoform_X1_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 1.186 Mitochondrial   Reliability : 1.347
 

Sequence

CDS
ATGTCTTTGAAGAATAGGTTAATTGCATGTCTGCAAAAACTGAAGGAATACGATTACACTGACGTAGACAAGGCAAGAGCTAGTGACGCGAAGGCCGAGAATGCCCTCAACTTAATATACCAGACTGCTTTAAAGAAAACAACTTTTACACCAGAAGAGAAGAAAATTGTAGGTTCTCTTTTATTTGATGCCATCACACCGATACAAAGCAACATAGAAGGAACGCTCTGCGAATACAGAACTAGATTAGATACCTCTGTGCTTATGAAAAGATCTGCAATACAATTCTTGATTGACGAATACGGGAAGTTTCCAGTTGAGAATTCTATCTTGGCTACAAAGTTAGAGGAAGCCGGCATAGCAGAGAGCGTTGAAATACTCAATGAAATTATAAATAGGACATCGGCGGTCCTAGCAGGAGGAGCAGTTGGATGCCTCGCAGGACCGGCAGGAGCTGCATTGGGAGGCGTATACGGAGGCATGATTACAGACGGCTTGGTTTCTGCGGCTAAGAACGAGCCTGTAGGTATTTTTGAGTCAAGTGCAAATATAGGTAGAGACATTGCTTCAGGCAAAAATCCAATGGCTTCTGTGGGTTCCGCAAGTTTCAAAATCGCCATGGACGGTATAGGTGGCTTTGGCATGGGAGGAGTTTCTAGCGTTGCCAGTAAAGTCCCGGCGAAGGCCGTCGCAAAAACCATAGAAGGCACTGTAAAAAAAGCTGCTGCAACTATTGGGGAGGAGATGATTGAGAAGTCAGTGCAATTAACTGCAGAAGAAATGACAAAAATTGTGGCAAAGAAAGTGTCAGAAAAAGCCGTGAAAAAAGCTGTCGAAACTGCAGCAATACAAACACAAATGCTTCTGGTGTCTGCTCACGTCGGAGTAAATGCTAGTGAAAAAACCAAAGCTGAAATGCGTGCTGAAGAAGAACGTAAACAACAGAAACAAAAAGAAGAAGAACGTAAACAACAGAAACAAAAAGAAGAAGAAAAAAAGGCGCGTGAAAAGCGCGATAAAAAAAACACTGGATCGTGGCAACCGCCACGCGAGAACAGAAACAATAAAGAGTCCAATGTTGATAATGAAGAGTCCGACGAGGAGGTATTTGAAAAGTTCATGAAATTACTTAAACAGCTCTTGAAGCTTCTCTACGGCAATAACAGCGAACCGTTCACAAGAATTTTCGAGAATTTATCACCAGGCCAAATAGCGTATTTGGTGAAAATAATCAGAAACCTTAACTCAACTGGAATTTTACAGATAGTGTTAGATTTTACATTAAAACTGTTTAAATTGTACTTTTCTAAAGATATCTCATTCACAAATATCCTGAGTATGTTAGAATTCGTCGCAACTTACATTGAAGACCAGTTGTATTTTATGACCAAAACCAAAGGTAAACCGACTCGTCAATCAGATGCCGACCGGAATGAGCGTCGAAGGAACGCCATCAGAGAACTTCAAAACAAAACGGATATAATTCAGAAAATTGCTGATCTATTCAGACATTTACAAGCGGAAATCATAGCTGAAACGAGCGCGCCTAATATAATTTCCCCCTATTTCCGTGATATATTCTCAGCTGTGTATCATTATTACAAACACAGACGCGTGCCCGTGCCAGGCCATGAGAAGCTGACAGTCAAACAATATTTCGACTTGATAAGGATGGTAATTATAAAAATGAAAGAATCACCGGAATACAAAAAAATGCAGAAGGCCAGAAATGGAACGACCCTCACTTGTGAAATGTACGTGGTCTTGTTCGGTAGGATGTTCAGAATTATTATTACTGTTCGAGATGGTGAAATTGTATTGAGTACCGCCTATGTAGTCAAGCGTATGAACTTTAATGCCAAAGAAGGCATTCTTTACATAAAATTCGGTGATGGAGATGTACAGAAGTAA
Protein
MSLKNRLIACLQKLKEYDYTDVDKARASDAKAENALNLIYQTALKKTTFTPEEKKIVGSLLFDAITPIQSNIEGTLCEYRTRLDTSVLMKRSAIQFLIDEYGKFPVENSILATKLEEAGIAESVEILNEIINRTSAVLAGGAVGCLAGPAGAALGGVYGGMITDGLVSAAKNEPVGIFESSANIGRDIASGKNPMASVGSASFKIAMDGIGGFGMGGVSSVASKVPAKAVAKTIEGTVKKAAATIGEEMIEKSVQLTAEEMTKIVAKKVSEKAVKKAVETAAIQTQMLLVSAHVGVNASEKTKAEMRAEEERKQQKQKEEERKQQKQKEEEKKAREKRDKKNTGSWQPPRENRNNKESNVDNEESDEEVFEKFMKLLKQLLKLLYGNNSEPFTRIFENLSPGQIAYLVKIIRNLNSTGILQIVLDFTLKLFKLYFSKDISFTNILSMLEFVATYIEDQLYFMTKTKGKPTRQSDADRNERRRNAIRELQNKTDIIQKIADLFRHLQAEIIAETSAPNIISPYFRDIFSAVYHYYKHRRVPVPGHEKLTVKQYFDLIRMVIIKMKESPEYKKMQKARNGTTLTCEMYVVLFGRMFRIIITVRDGEIVLSTAYVVKRMNFNAKEGILYIKFGDGDVQK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
636
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.42831
Exp number, first 60 AAs:
0.00024
Total prob of N-in:
0.48027
outside
1  -  636
 
 

Population Genetic Test Statistics

Pi
273.728122
Theta
173.686184
Tajima's D
0.559429
CLR
0.765212
CSRT
0.531923403829809
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 SAIQFLIDEYGK 100.00 3e-09
28556443 EYDYTDVDK 100.00 2e-05
26280517 NDPVVITDFHDGPGWK 100.00 7e-04
28556443 IAMDGIGGFGMGGVSSVASK 100.00 7e-04
28556443 IAMDGIGGFGMGGVSSVASK 100.00 7e-04
28556443 LDTSVLMK 100.00 0.011
28556443 AENALNLIYQTALK 100.00 0.026
28556443 AENALNLIYQTALK 100.00 0.026
28556443 AENALNLIYQTALK 100.00 0.026
28556443 AENALNLIYQTALK 100.00 0.026
28556443 AENALNLIYQTALK 100.00 0.026
28556443 AENALNLIYQTALK 100.00 0.026
28556443 ASDAKAENALNLIYQTALK 100.00 0.026
28556443 KHTLPELPYEYNALEPVISR 100.00 0.026
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号