SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11259
Pre Gene Modal
BGIBMGA004685
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.802
 

Sequence

CDS
ATGGACAGGTTACATAATACGTTTGGGATAACGAATAGGGCGTCGCCGCGAAACGACGCGCAGAAATATCGCCCTACATCTGCGAACAATATACTAGGGCTACCGAGTCATGGACGGGCTCGGCTAATGAAGTTAGTCCCAAATTGTAGCCTGAAATTCCGCTTCGCTACATTGAATGTTGGAACACTAACGGGGAAGACAAAGGAACTTGCTTCACTCTTCAAGCGTAGAAAGGTAGATTTCGCTTGCCTTCAAGAAACCAGATGGACTGGTGCAAAAGCCCTTAACATCGGAGAAAGCTACAAACTCATGTATGTAGGCGCTAGGCATGGAAGAAATGGTGTAGCAATCGCTGTCAAAGCCGAACACCTCGAAAACTTCTTAGAAGTAAATCGAATTAACGACAGGCTGATGTCTCTAAAAGTACTTGTTGAAGGGGAAGTCATAAATGTGATATCAGCTTATGCTCCCCAGGCGGGTTGTAGCAGGGCTGAAAAAGATAGTTTTTGGACAACTTTGGAAGATCATCTACGCCAAATACCTTCGAAGGAGACAATGCTGTTGGGTGGGGACTTAAACGGTCACATAGGGACAGAAAATAAGGCCTTTAAAAGAGTGCACGGAGGTCATGGATTTGGCACTATAAACGAGGAGGGGGAAGTTATTCTTTCAACAGCTGCTGCATTTGATCTTGCTATAACAAATACTTTCTTTGCTAAAAAGCCAGAACATACAATTACATACAAAAGTGGACAAACAACATCGCAGATAGACTATATATTAGTAAATCGAGCTTACATAGGCCGGGTAACAAATTGCAAGGTCATCCCGGGAGAATGCGCCGTTACTCAACATCGTATCGTTGTAATGGATATGCTTTTTAAGAAAACATCTAAAACTAAAACATCTCACACTCCGGAAATAACCAAATGGTGGAACTTAAAAGGAGATAAGATCCCCGAATTCTGTAACCATCTGAGCAACTTGAAAGTTGATACTGAGTTGGATATTGACAATATATGGGATCACCTTAGCAAATCCATTGTAAAAGCTGGTAATATTACTCTTGGTCGTACAAAAGGTGGTAGAATAAACAATAAAGAGACTTGGTGGTGGACAGAAGCAGTACAAAATGCCATTCAAAAGAAAAAAGATGCCTTTAAGACCTGGCAGTCCACCCAAACTTCTGAAGACCAAGAAAGATATAAAAGAATAAAGAAGGAGACTAAGAAAATAGTGGCAGTGGAGCGCGCAGTTGCCCTAAAGACCATGTACGAGCAACTGGAAACAAAAGAAGGTCAAAAATGTATATTTAAGCTCGCTAAACAGCGTTGTTGGAGCACGAGGGATCCCACTAGATGTCGGGCTGTTAAAGATCCAAATGGTGAGCTTCTGTATGGGGATAGTGATGTACTATCAGCTTGGCATCAATATTATGAACAGCTACTAAACCCTACTCAAGCTGCTATACAGTTAACAAAAGTGGGCAGGAACATTGGACTTATACCTCCAATACGTCCAAATGAGGTCAAAATGGCGTTAGAAAAGATGGCCAACAAGAAAGCCACGGGACCGGACGGTATTCCAGTGGAAGCTTGGAAGTGCCTTCGTGAGCACGGAATCGAAACGCTCACCAAACTTTTCAACTGTGTGTTGCGCTCTTCCAAAATGCCAGCGGCGTGGAGATTGAGCACCATAGTTCCTATTTATAAGGGGAAGGGCAGTAAGTACGAATGTAACAACTATCGCGGGATCAAGCTGTTAAGCCATACTATGAAACTGTATGAAGGAGTGATTGACAGCCGCCTAAGATCAGAGTGTTCACTATCCAAAAATCACTATGGTTTTGTACAGGGCTTATCTACCACCGACCCTATGTTTGCTCTAAATACGATCGCTGAGGAGTATCGTGAGAAACTTCGGCCATTGTATGTCGCATTCTTAGACATGGAAAAGGCATTTGACCGTGTGCCAAGAGATACGATCTGGTGGAGCCTTCGCAAGAAGATTGTACCCGAACATTATGTTAACGTCATAATTGACATGTACAGGGATGCGAGGTCAATGGTACGGACAGTAGTGGGTCAGACAAAACCAATAGCAGTTGCAGAAGGTCTGCATCAAGGTTCAGTACTGAGTCCCTTTCTGTTCGGCATGGTTATAGACTCACTCACTGAGGTGGCGCAGTCCTCAGCCTCGTGGACTTTCATCTATGCAGACGACGTTGCTATCTGCACCGAGAGCCGCACAAAGCTACGAGAGGCACTCCTGTTGTGGAAACAGCAGTTACAAGCCGGTGGCCTAATATTGAGTGTTGCGAAGACACATTACATGTCTTTTAATGACCCAGATCCAGGTGACAACAGTCCGATTTCCATTGACGGTCAACTTGTAAACATGTGCGATCAATACAAGTATCTGGGTACTATGATGCACAGATCTGGAAATTTAAAATGCAACATTCAACACCGAATAGCCGCAGCATGGCTAAAATGGCGAGAAGTAAGTGGTGTCACCTGCGATAGGAGGATGCCCGTTAAGCTCAAGGGTATGATCTATAAGACTATAATAAGGCCTGTTCTTATGTATGGCAGCGAAACATGGGCGGCAACCAAAAGGAACGTACATACCATTCAAGTTGCTGAAATGAAAATGCTGAGGTGGATGTGCGGCGTGACTAGGCTCGATAAAATCCGCAACGAGTACGTGCGTGGAAGTCTAGGTGTACGGGACATCGCCGACAAGATGCAGGAGAGTAGGCTGAGATGGTATGGTCACGTGAAAAGGAAGCAACCTGACTACGTCGGAAATTTGGCGCTACTGCTCGACCTCCCCGGTCGGAGACCTAGAGGCAGACCCAAGACAAGGTGGAGGGACGTAGTGCTGAAGGACAAGAGAGAATGCAATGTTGCTGACGAGGATGTCGAAGACAGAGCGAAGTGGAGGAGTAAAGTCAGGAAAGCTGACCCCACCACCATGTGGGATAAATAG
Protein
MDRLHNTFGITNRASPRNDAQKYRPTSANNILGLPSHGRARLMKLVPNCSLKFRFATLNVGTLTGKTKELASLFKRRKVDFACLQETRWTGAKALNIGESYKLMYVGARHGRNGVAIAVKAEHLENFLEVNRINDRLMSLKVLVEGEVINVISAYAPQAGCSRAEKDSFWTTLEDHLRQIPSKETMLLGGDLNGHIGTENKAFKRVHGGHGFGTINEEGEVILSTAAAFDLAITNTFFAKKPEHTITYKSGQTTSQIDYILVNRAYIGRVTNCKVIPGECAVTQHRIVVMDMLFKKTSKTKTSHTPEITKWWNLKGDKIPEFCNHLSNLKVDTELDIDNIWDHLSKSIVKAGNITLGRTKGGRINNKETWWWTEAVQNAIQKKKDAFKTWQSTQTSEDQERYKRIKKETKKIVAVERAVALKTMYEQLETKEGQKCIFKLAKQRCWSTRDPTRCRAVKDPNGELLYGDSDVLSAWHQYYEQLLNPTQAAIQLTKVGRNIGLIPPIRPNEVKMALEKMANKKATGPDGIPVEAWKCLREHGIETLTKLFNCVLRSSKMPAAWRLSTIVPIYKGKGSKYECNNYRGIKLLSHTMKLYEGVIDSRLRSECSLSKNHYGFVQGLSTTDPMFALNTIAEEYREKLRPLYVAFLDMEKAFDRVPRDTIWWSLRKKIVPEHYVNVIIDMYRDARSMVRTVVGQTKPIAVAEGLHQGSVLSPFLFGMVIDSLTEVAQSSASWTFIYADDVAICTESRTKLREALLLWKQQLQAGGLILSVAKTHYMSFNDPDPGDNSPISIDGQLVNMCDQYKYLGTMMHRSGNLKCNIQHRIAAAWLKWREVSGVTCDRRMPVKLKGMIYKTIIRPVLMYGSETWAATKRNVHTIQVAEMKMLRWMCGVTRLDKIRNEYVRGSLGVRDIADKMQESRLRWYGHVKRKQPDYVGNLALLLDLPGRRPRGRPKTRWRDVVLKDKRECNVADEDVEDRAKWRSKVRKADPTTMWDK

Summary

Uniprot
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
1VYB     E-value=5.04226e-05,     Score=115

Ontologies

Topology

Length:
996
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00634999999999998
Exp number, first 60 AAs:
0.00126
Total prob of N-in:
0.00023
outside
1  -  996
 
 

Population Genetic Test Statistics

Pi
232.970496
Theta
161.351979
Tajima's D
1.476154
CLR
0.666054
CSRT
0.780960951952402
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号