SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11210
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.215 Mitochondrial   Reliability : 1.372 Nuclear   Reliability : 1.399
 

Sequence

CDS
ATGAGGTTATCGCAGTCTAATTACCATCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTCGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCTGGCGCGGTGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACAGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGGGGGTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MRLSQSNYHHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAVEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAEQERESSSSLSAPCRRRRAGGRRRAFVQLQPL

Summary

EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    LBMM01009501    KMQ88083.1    + More
KZ150386    PZC71062.1    KZ149950    PZC76665.1    KZ150308    PZC71477.1    AB078935    BAC06462.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01012027    KMQ86470.1    QOIP01000009    RLU18544.1    LBMM01006538    KMQ90523.1    LBMM01008861    KMQ88580.1    ODYU01009945    SOQ54696.1    RSAL01003504    RVE40273.1    RSAL01000481    RVE41577.1    LBMM01003679    KMQ93242.1    LBMM01006954    KMQ90166.1    KQ460685    KPJ12887.1    D85594    BAA19776.1    LBMM01008682    KMQ88705.1    LBMM01024024    KMQ82631.1    LBMM01009494    KMQ88097.1    LBMM01014132    KMQ85305.1    LBMM01006110    KMQ90925.1    LBMM01006662    KMQ90413.1    GL450953    EFN80213.1    LBMM01006671    KMQ90407.1    LBMM01006725    KMQ90373.1    LBMM01006657    KMQ90417.1    LBMM01002052    KMQ95336.1    LBMM01005634    KMQ91349.1    LBMM01005733    KMQ91252.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01019838    KMQ83439.1    ABLF02023401    ABLF02029423    ABLF02060278    LBMM01019839    KMQ83438.1    QOIP01000010    RLU18098.1    QOIP01000031    RLU14697.1    GGMR01011682    MBY24301.1    LBMM01014909    KMQ85000.1    QOIP01000007    RLU20280.1    LBMM01007088    KMQ90053.1    CH963857    KRF98317.1    GGMR01012534    MBY25153.1    LBMM01004152    KMQ92762.1    GFXV01003903    MBW15708.1    LBMM01007425    KMQ89740.1    LBMM01002480    KMQ94776.1    LBMM01015018    KMQ84954.1    LBMM01011877    KMQ86578.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF17919   RT_RNaseH_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
260
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04416
Exp number, first 60 AAs:
0.01972
Total prob of N-in:
0.08969
outside
1  -  260
 
 

Population Genetic Test Statistics

Pi
207.392854
Theta
77.805812
Tajima's D
4.51511
CLR
116.849781
CSRT
0.99990000499975
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号