SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11209
Annotation
NA
Location in the cell
Nuclear   Reliability : 1.98
 

Sequence

CDS
ATGTTTATGTGGTTTAGTTTGGCAGTTATTATTTATTCAAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAGAGCGAGAGAGAGCGAGAGAGAGAGAGAGAGAAAGCAGTCAACAGATAG
Protein
MFMWFSLAVIIYSRERERARESERERERERARESERERERERERARERERESERERERERARESERERERERARESERERERERERARERERERERERARERERERERERARERERESEREREREREKAVNR

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
132
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04917
outside
1  -  132
 
 

Population Genetic Test Statistics

Pi
174.794881
Theta
132.501194
Tajima's D
1.002709
CLR
0
CSRT
0.660166991650417
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号