SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11173
Pre Gene Modal
BGIBMGA012643
Annotation
PREDICTED:_protein_FAM91A1_[Papilio_machaon]
Full name
Protein FAM91A1      
Location in the cell
Cytoplasmic   Reliability : 1.511 Mitochondrial   Reliability : 1.214
 

Sequence

CDS
ATGGAAGAGGAAATTGAAGACTGCATAAGAAAGAAAATCCACTGGGCACAGTTACCTCAAACTGTGAGAAAGCTACTAGGTGACTCTCCGAAGGAATACGATAGACACATTTTTGAATTCAGTATAAAAAACCAATTGAGATATAGAGGCAGTCTCGTTAGAACGGTTAAGAAAGACGAGAAGAAATACTATGAGGTTCTTGTGCAAAACAGCATACAGAAGCTTATGCTCTACCCCTATCACTTAGCTGATATGATCGTTAAAGGATTAAGGATAACCCCATTTATTTATTATGTAGAAGTGGTGGCACTTCTGATTGAGTTGGAGAAAAGCTACGATACAATGCCTAATTTTACAGCAGCTGACTGTCTCCGCCTATTAGGCATAGGTCGTAATGAATATCTGGAATTAGTAGCTAAAGCTAGGTCACTGGGCCGCCGAGGCAGATCAAAAGCTATTCGTTCTTTACTGCCACGAGTACCACAGAACGTTCCGATGCAGCCGTGGTGGAGAATCGAACTGGGCTACGTACTGGAGGAAGACGTTAAGCCGCTGAGTGAGAGTGAAGTGGCCGTCATTGACGTACTGATAGATCGAGGGTCACAGACTGCAGGTACACTCGACTATAACATCGTTAAGAGCCTGTACAGACGGGGTCTGGTGTACGTGGACGTGCCCATAACGGCGGCTGATAAGGTGTCCGTCCCTCCGTTGAAGGGCTTCGTCATGAACCGTGTGGCCGGGGACTACTTCGAGACCTTGCTGTACAAGGTGTTCGTTTCCATCGACGAGCACACCGGGGTCGGGGAACTTGCTGCCGTCCTCCAGGTTGACTGCGAGCTGGTGAAGCAAGCGGTGTCGCTGTACTGCCGGCTTGGGTTCGCGAACAACCTGCACCCCCCGCCCGTCTCCCCGCCGCACCCCTCCTGGAGCGACGCGGTCACGACACACACCCATCCGCCGTACCGACAAATAACACCTTTGACCTTTGACCCGGGAGTCGATGAGGAAACTCTGCAAATGGAACCGGTGCTTCTGAAAGACGCCCCATCTACTTCCAAACAGATGCATGAAACTCCTGAGGGATCCGGGGGCGGTGGCCGTCGGGTAGCCGTGCTGTTTGACTCGACACTCGCCGCGTATCTGATGATGGGCAATCTGTCACCGGATCTAAAAAGTCACGCCGTGACTCTATTCGAAGTCGGAAAGCTGAGCGACGAAAGCTTGGACAGCCTGCTGTTGGAACTAGACAAGGTCGTAGCAGATCCAGAGATAGAGGGCGAAGCCCGGCGGTACTTGGCGGCGGCGGCGTGTCTCCGGACTGCACTGCGGGTGCTCCGCCCCAAGCTGAGGCCCCTCGACCTGCTGCGGTGCGAAGCGTTGCACGCCCTAGGACATCAGTCCAGGACCAGGCTCCTCGCTACTAAGTACAGGGCAGCTATAGCCACAGCGCCGCTGTGCCGCGAGGCGCGCGCGGGGGCGGCGGCGGGGGGGCTGCCGCTGGTGGGGCCCGCGCCCCCCGAGGCGCACTCCCCCTGGATGAGGCTCTACATCTACCACGTTGCCGGGTACGGACCCCCCACGCTACTGCTTAAAAAAGGGAGCTTCCTGCGCAGCATGCCCCGTCTGCTGCTGGGCTACTCCCGGCTGGGGGTGTGGTGGTGGGGCGCGGAGTGCGCGGTGGAGAGCTCGGGGGGCGTGGCCTCGTGCCTGCCCGCGGCCGCCGCGCTCGCCGCCGCCAACACGGCCCTGCGCCGCGCCCCCGTGCTGCTGCAGGCCATGGGGGTCAGGGCCGCCGCTGGACTGCGGCACCTCATGTTCCCGCCTGAAGATGACCCTCTCACAGAGAACCAAGTGTTTTGGGCTCAGCACGCGGGGCTGCGGCGGCTGGCGCGGAGGCTCCGGCTGCAGCGCTCCGCCGGCTACGTGACGCTGGCCGACATCGGGGTGCCCGACCTGGGCTGCGCCAGCCCGCCCGCCGCCGTGCAGCTGGTGCCACAACGCAAGAAGAAAGAAATATGCGGCATCGCGAAACCGGTCCCCGACACGTCGCCCGCGGACAACAGCGCGCGGCTCCGGTCGCCCATAGAGTCGCACTTCGCCGTGACGCCGACTGGGCCCAGCGCGCACGGCTCGCCGGCCAACGGCTTCACCAGCGCCGACGGCGGCCGCCTCCTCCGCGAGGAGCTGGACTACCTCGACGCCAGCGAACCCCCAGGACCGCCCCCGCCGACGACGACCTCTAAAGAATCGATAGTCGACATAGTGTTGGTCAACGATAATATCGATATGAAGAGTTCGATGTGTAGTGATGTCGCGCCGGTGCACTGGAGTAAGTCGATGGACCGGCTCGGCGAGCTCCTGAGTCCGGCCGAGGAGACCATATCGATGTTCACGCAGCTGAGCGACAAGCTGAGCGAGGTGTCCGCGGCCGAGGGGGACAGCGGCGTCGACACGGCGCACGTCTCCGACGACGAAGCCTGCAGGCCAGAGAAATGGACGATACTGGACCTGCAGTTCGGCATCCCGCTATTCGACGAGGCGCTTTGCGAGTCCGTGTGCGGCAGCGTGGTGGGCTGTGTGGCGGCGCCAGACGTGTGA
Protein
MEEEIEDCIRKKIHWAQLPQTVRKLLGDSPKEYDRHIFEFSIKNQLRYRGSLVRTVKKDEKKYYEVLVQNSIQKLMLYPYHLADMIVKGLRITPFIYYVEVVALLIELEKSYDTMPNFTAADCLRLLGIGRNEYLELVAKARSLGRRGRSKAIRSLLPRVPQNVPMQPWWRIELGYVLEEDVKPLSESEVAVIDVLIDRGSQTAGTLDYNIVKSLYRRGLVYVDVPITAADKVSVPPLKGFVMNRVAGDYFETLLYKVFVSIDEHTGVGELAAVLQVDCELVKQAVSLYCRLGFANNLHPPPVSPPHPSWSDAVTTHTHPPYRQITPLTFDPGVDEETLQMEPVLLKDAPSTSKQMHETPEGSGGGGRRVAVLFDSTLAAYLMMGNLSPDLKSHAVTLFEVGKLSDESLDSLLLELDKVVADPEIEGEARRYLAAAACLRTALRVLRPKLRPLDLLRCEALHALGHQSRTRLLATKYRAAIATAPLCREARAGAAAGGLPLVGPAPPEAHSPWMRLYIYHVAGYGPPTLLLKKGSFLRSMPRLLLGYSRLGVWWWGAECAVESSGGVASCLPAAAALAAANTALRRAPVLLQAMGVRAAAGLRHLMFPPEDDPLTENQVFWAQHAGLRRLARRLRLQRSAGYVTLADIGVPDLGCASPPAAVQLVPQRKKKEICGIAKPVPDTSPADNSARLRSPIESHFAVTPTGPSAHGSPANGFTSADGGRLLREELDYLDASEPPGPPPPTTTSKESIVDIVLVNDNIDMKSSMCSDVAPVHWSKSMDRLGELLSPAEETISMFTQLSDKLSEVSAAEGDSGVDTAHVSDDEACRPEKWTILDLQFGIPLFDEALCESVCGSVVGCVAAPDV

Summary

Description
As component of the WDR11 complex acts together with TBC1D23 to facilitate the golgin-mediated capture of vesicles generated using AP-1.
Subunit
Component of the complex WDR11 composed of C17orf75, FAM91A1 and WDR11; FAM91A1 and WDR11 are required for proper location of the complex (By similarity). Interacts with golgins GOLGA1 and GOLGA4 and with TBC1D23; interaction with golgins may be mediated by TBC1D23 and interaction with TBC1D23 recruits TBC1D23 to AP-1-derived vesicles (PubMed:29084197).
Similarity
Belongs to the FAM91 family.
Keywords
Complete proteome   Cytoplasmic vesicle   Golgi apparatus   Phosphoprotein   Reference proteome  
Feature
chain  Protein FAM91A1
EMBL
NWSH01000823    PCG74012.1    ODYU01002616    SOQ40348.1    KQ461073    KPJ09574.1    + More
AGBW02014073    OWR42318.1    KQ459053    KPJ04037.1    BABH01038918    BABH01038919    BABH01038920    KZ149982    PZC75777.1    KQ971382    EEZ97172.2    APGK01038498    KB740960    KB631698    ENN76984.1    ERL85474.1    GEZM01063052    GEZM01063051    JAV69347.1    KK852927    KDR13698.1    GBBI01003587    JAC15125.1    JH817025    EKC27428.1    AAAB01008859    EAA07548.6    GDHC01019757    GDHC01014955    JAP98871.1    JAQ03674.1    GBHO01030119    JAG13485.1    GECU01009708    JAS97998.1    GECU01021057    JAS86649.1    DS232718    EDS45097.1    GEDC01029987    JAS07311.1    GEDC01015637    GEDC01014298    GEDC01009046    JAS21661.1    JAS23000.1    JAS28252.1    AFYH01115239    AFYH01115240    AFYH01115241    AFYH01115242    AFYH01115243    AFYH01115244    AFYH01115245    AFYH01115246    GGFJ01001996    MBW51137.1    GGFK01002845    MBW36166.1    GABZ01004404    JAA49121.1    GGFJ01001994    MBW51135.1    GGFJ01001995    MBW51136.1    ADMH02001309    ETN63061.1    ATLV01014080    KE524939    KFB38321.1    CM004477    OCT75004.1    BC157555    AAI57556.1    AADN05000663    GGFM01006763    MBW27514.1    LSYS01001531    OPJ88352.1    GGFM01001625    MBW22376.1    AAQR03010449    AAQR03010450    MUZQ01000006    OWK64052.1    AAGW02013247    NEDP02000216    OWF56343.1    AAKN02041902    AAKN02041903    DQ228142    CH466545    ABB17071.1    EDL29306.1    AK122297    AK137324    BC033609    BC070426    AXCN02000323    GAMT01008998    GAMS01007434    JAB02863.1    JAB15702.1    AABR07058013    BC166852    AAI66852.1    GAMR01003446    GAMP01007980    JAB30486.1    JAB44775.1    ABQF01006287    QUSF01000001    RLW13027.1    AEYP01013736    AEYP01013737    GEBF01005546    JAN98086.1    AANG04003518    HAAF01002019    CCP73845.1    AAEX03008786    ACTA01050818    ACTA01058818    ACTA01066818   
Pfam
PF14647   FAM91_N        + More
PF14648   FAM91_C
PF13891   zf-C3Hc3H
PF00561   Abhydrolase_1
Interpro
IPR028097   FAM91_C_dom        + More
IPR039199   FAM91       
IPR028091   FAM91_N_dom       
IPR000048   IQ_motif_EF-hand-BS       
IPR025927   Potential_DNA-bd       
IPR019824   Leghaemoglobin_Fe_BS       
IPR029058   AB_hydrolase       
IPR000073   AB_hydrolase_1       
SUPFAM
SSF53474   SSF53474       
Gene 3D

Ontologies

Topology

Subcellular location
Golgi apparatus   Recruitment to the TGN requires the presence of GOLGA1, GOLGA4 and TBC1D23.   With evidence from 2 publications.
trans-Golgi network   Recruitment to the TGN requires the presence of GOLGA1, GOLGA4 and TBC1D23.   With evidence from 2 publications.
Cytoplasmic vesicle   Recruitment to the TGN requires the presence of GOLGA1, GOLGA4 and TBC1D23.   With evidence from 2 publications.
Length:
866
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.31879
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01518
outside
1  -  866
 
 

Population Genetic Test Statistics

Pi
209.432063
Theta
172.847317
Tajima's D
0.752941
CLR
0.132403
CSRT
0.590770461476926
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号