SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11168
Pre Gene Modal
BGIBMGA007302
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.721
 

Sequence

CDS
ATGAATATACGATCAATGCTTTGGGATCAATGTGGTTCAAGTGAAGCGAACTGGAACAATCTGAAAAAGGTTGTACTGGATACGGCTAAACAAAGCAGAGATCTACACAAAGCAGTTCCTAAACATGAAAAATGGATTAGCAAGGAGTCATGGATGTTGATAGAGGAAAGGAAAAGACTAAAAGAACAAGGCATTGTAAACAATAGTCAAAAGGAGCGCTACAATCAATTGCATGCAGAGATTCAAATGTCTACTCGGAGAGACAGAGATGAGCACATGAACAATATATGTGAAGAAATTGAGGGACATGCTGATAAAGTGCAGACTAAGGACCTTTTCCTGAAAGTGAAGCAGCTAACAGGTGTCTTCAAGCCGAATAAATGGGTTATCGAAGATAGTAGAGGTAACACCTTGACAGAAATGGAACATGTTTTGGAGAGGTGGAGAAACTACTGTTATGACCTATATCGCGATGAAGACAATTTATGCACCGTCAAAAGATGGGATGACCACCTGGAAGAGCCTCCTATACTACTTTCTGAGGTTGAATATGCAATACAAAAACTTAAGCACAAGGTGGTTGGTCCGGATGGCGTGTCGGCAGCGATGCTTCAAAGTCTCGGTTCAGAAGGGATAAACATTATCCATCAGATATGTACCAAGATCTGGAAAACAGGCCAATGGCCCAGTGATTGGACAAAATCTGCAATAGTACCACTTCATAAGAAAGGCTCCACAGCGAAGTGTGAGAACTACCGAACTCTGTCGCTCATGTCCCACGCGAGTAAAATACTCCTTCGCATAATAAACAGCAGACTATCAGCTTTCATAGACCACCAGATACCAAGAGAACAGGCTGGTTTTGTAGCTGGAAAAGGAACTCGCAAGCAAATTTTGAACGTCCGAGTGCTCATTGAGAAATTTCGCGAGTTTAACAAGTCTCTGGTGCTATGCTTTATAGATTATGCGAAGGCGTTTGACTGTGTTCAGTGGAGTAGCATGTTTGATGTGTTGATTGATATGGGCGTTCCTTCTCATCTCACACTACTGATACGGAATCTGTACCTTGATGGCTCTTGCTTCGTGAAACTAGATAATCGAAGATCTAAACCCTTCCATACAGAACGTGGAGTGCGTCAGGGCTGCATTCTGTCACCCAAATTATTTAATATCTACGGCGAATATATAATAACAAGAGCACTTGAAAGCTGGAACGGCGGTATTTCCGTGGGCGGTGAACACTCACAAACCTGA
Protein
MNIRSMLWDQCGSSEANWNNLKKVVLDTAKQSRDLHKAVPKHEKWISKESWMLIEERKRLKEQGIVNNSQKERYNQLHAEIQMSTRRDRDEHMNNICEEIEGHADKVQTKDLFLKVKQLTGVFKPNKWVIEDSRGNTLTEMEHVLERWRNYCYDLYRDEDNLCTVKRWDDHLEEPPILLSEVEYAIQKLKHKVVGPDGVSAAMLQSLGSEGINIIHQICTKIWKTGQWPSDWTKSAIVPLHKKGSTAKCENYRTLSLMSHASKILLRIINSRLSAFIDHQIPREQAGFVAGKGTRKQILNVRVLIEKFREFNKSLVLCFIDYAKAFDCVQWSSMFDVLIDMGVPSHLTLLIRNLYLDGSCFVKLDNRRSKPFHTERGVRQGCILSPKLFNIYGEYIITRALESWNGGISVGGEHSQT

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR027124   Swc5/CFDP2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
417
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02081
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01066
outside
1  -  417
 
 

Population Genetic Test Statistics

Pi
0.052311
Theta
0.823916
Tajima's D
-1.729982
CLR
123.555933
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号