SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11159
Pre Gene Modal
BGIBMGA008587
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.718
 

Sequence

CDS
ATGTCACTTATATCAAATTTGAAATCCTTTGATGGAGAAAAGTGGTCAGTGTTCCAGGAACAGTTAGACTGTTTCTTTATCGTTAATGAAGTGTCCGATGAAAAAAAAGTACCACTATTAATCACTAAATTAGCACCCAAAGTTTATGAAGTCCTCTCTTATTTATGTAAACCAAAAAAACCACAGGATCTAAAATTTGACCAACTTTGTTTCAAGTTAGCAGCAAAATATGATCAAAAACTACCATCAGCCATTGAAAGAGCAAATTTCAGACAGCGGAACCAGGCACCGAATGAAAAAGTAGAAGATTACGTCTTGGAACTGAGGAAACTTGCTGCAAAATGTAACTTCAAAGATATGGAGGACCAAGTCAAAGAGAAACTAATGGACGGAGTGTCCTCAAAAATGATAAAGTTTGAATTGATGAAGAGTGCTGGTGATGCAACACTAGAAAGGTGTATTGAATTAGCCCGCACTGTTGAAGCAGCAATATTACAAACAAACGGGGCCACAAATGAAGTTGCGGAAATATTTGTCAGCAAATCAACCAATAAATCACCACAACAGCAAAGAAATACCTACCAACAAAAAAATCAATGTTACTGCTGCGGAAAATGGAACCACCTAAAGCGGGACTGCAGACTCAATAGAAAATATTGCTCTGAATGTGGAATTCAAGGACACATCTTCAGAATGTGTCCCAAGAAGCAAAGAAAAGTAAATGTTCTGCAGGAAGATAACCAACAAAAGGATAAAAATACAGATAATGAACCCACTGAGTTTGAACCAAAATATTATGAAACATATGCATGTAACACTGTGAGTAAAATACCACCTTACTACATAACCATAAAAATGGAGGAGTGTAAGCTACCATTTCAACTAGACACCGGCTCAGAAGTGACAGTAATCACGGAAAATGACAAAAATGACATTTTAATAAACCACGTACTGCAAGATTGTGACATAATATTTAAAAATTTCGATCAATCCACAACAAGGCCACTAGGCATAGTTCATAATATATCTGTAGAATATGGTAACAGAAGTGTTTACTTAAAAGCTTTTGTAGTAAAAAATAAGTCACCCCGCATAATAGGCAGAGATTGGCTAAACGCCTTAGATGCACAAAATAGTATAGAAAAAAAATTCGCAGCAGTATTCAGCCCAGGCTGGGGAAATTTCAAAGGCGATGTCATAAATTTAGTTTTGAAAAAGGAGGTAGAACCCAAGTGTTTACCAGTGAGACGCGTACCATATGCTCTTAAGGACAAAGTAAATAATGAAATAAAAAGATTATTGGACAATGGTAGGATCACAGTAGTAAAACACAGTAAATGGGGCACCCCTGTAGTACCAATTTTAAAATCGGATGGTTCAGTAAGATTGTGTGGAGATTACAAGTTAACAGTAAACAAGTGTTTGGAAGTAGATCATTTCCCTTTACCGCATGTTGAAGACATTATAAACACCCTACAAGGGGGCGAATATTACTGCGAATTGGACTTAAAAGAAGCATATTTGCAAGCGCCTTTAAGTTTAGAAAGCCAGGATTGCACAACCATTGTAACCGAGATAGGAACATACAAATATAATTATTTACCATATGGGGTCAGTTCAGGACCTGGTGCATTTCAGCGTCTAATGACTAAAAAGTTGGAAGGGTCGCGGCGCGGCGCGGCGGGCGTGTGCGTGCGGGCGCGGCGCGGCGGCGGGCGGGCGGCGCTGCTGCGGCGGCTGGCTCGCTGGCCGCGCCTGCACCACGACCGCCTCTCCTTCACCGTCGACGTCTTGTACCACTCGGACGAAGCCACGATCTTCAGAGTGGGCGGCGTCGTCAAATTGACGTCTGATTGTCTTGCTGACGAAGAAGAGATGATCTACTTCAGCAGGACCTTGGTGCTGAAGGCTGAAGGCACGACAGAATACAAGATACATAACGAAATGCTTTACTGGGACGAAGTCACCGACCAAACTGCAAAAGCCGCCTTCCAGGTAACGGAGGCATACAATTGA
Protein
MSLISNLKSFDGEKWSVFQEQLDCFFIVNEVSDEKKVPLLITKLAPKVYEVLSYLCKPKKPQDLKFDQLCFKLAAKYDQKLPSAIERANFRQRNQAPNEKVEDYVLELRKLAAKCNFKDMEDQVKEKLMDGVSSKMIKFELMKSAGDATLERCIELARTVEAAILQTNGATNEVAEIFVSKSTNKSPQQQRNTYQQKNQCYCCGKWNHLKRDCRLNRKYCSECGIQGHIFRMCPKKQRKVNVLQEDNQQKDKNTDNEPTEFEPKYYETYACNTVSKIPPYYITIKMEECKLPFQLDTGSEVTVITENDKNDILINHVLQDCDIIFKNFDQSTTRPLGIVHNISVEYGNRSVYLKAFVVKNKSPRIIGRDWLNALDAQNSIEKKFAAVFSPGWGNFKGDVINLVLKKEVEPKCLPVRRVPYALKDKVNNEIKRLLDNGRITVVKHSKWGTPVVPILKSDGSVRLCGDYKLTVNKCLEVDHFPLPHVEDIINTLQGGEYYCELDLKEAYLQAPLSLESQDCTTIVTEIGTYKYNYLPYGVSSGPGAFQRLMTKKLEGSRRGAAGVCVRARRGGGRAALLRRLARWPRLHHDRLSFTVDVLYHSDEATIFRVGGVVKLTSDCLADEEEMIYFSRTLVLKAEGTTEYKIHNEMLYWDEVTDQTAKAAFQVTEAYN

Summary

EMBL
GEDC01013717    JAS23581.1    GEDC01021971    JAS15327.1    GEDC01007675    GEDC01003661    + More
JAS29623.1    JAS33637.1    HADZ01011823    HAEA01016148    SBP75764.1    GGMR01020219    MBY32838.1    GEDC01023506    GEDC01023205    JAS13792.1    JAS14093.1    NIRI01002335    RJW62347.1    HAEB01010230    SBQ56757.1    RQTK01000185    RUS85038.1    GEFM01006397    JAP69399.1    LBMM01006119    KMQ90911.1    GFAC01001149    JAT98039.1    GEZM01051399    JAV74971.1    ABLF02012266    ABLF02012271    KL367479    KFD72009.1    ABLF02036937    NIVC01000860    PAA75827.1    ABLF02026830    ABLF02041879    KL363215    KFD53596.1    KL363295    KFD48373.1    ABLF02006499    GEZM01092768    GEZM01092767    JAV56467.1    ABLF02030002    GEZM01085308    JAV60010.1    JYDW01000004    KRZ62956.1    JYDJ01000151    KRX42156.1    NIVC01000363    PAA84717.1    NIVC01001652    PAA65446.1    EF199621    ABM90392.1    RSAL01000130    RVE46453.1    NIVC01000555    PAA80976.1    LBMM01008360    KMQ88942.1    EF199622    ABM90393.1    GGLE01005288    MBY09414.1    KV461060    OCA14951.1    ABLF02016687    ABLF02016690    NIVC01001377    PAA68677.1    GEZM01009753    JAV94337.1    GEZM01036245    JAV82862.1    NIRI01001696    RJW65585.1    LBMM01010146    KMQ87646.1    ABLF02012827    ABLF02012828    ABLF02015552    ABLF02041322    ABLF02008248    ABLF02008249    ABLF02008250    ABLF02035153    ABLF02037855    ABLF02037866    ABLF02061872    MRZV01000174    PIK56483.1    GEZM01050895    JAV75318.1    GGMR01017626    MBY30245.1    GFPF01012842    MAA23988.1    NIVC01001308    PAA69606.1    NIVC01000538    PAA81343.1    NIVC01000264    PAA86792.1    GFWV01017841    MAA42569.1    AAZX01023237    KL367711    KFD59948.1    KL363391    KFD46136.1    GEZM01051546    GEZM01051543    JAV74825.1    GEZM01051545    GEZM01051542    JAV74826.1    KL367556    KFD64442.1    RQTK01001807    RUS69146.1    JYDL01000185    KRX13745.1    KL363282    KFD48880.1    JYDO01000426    KRZ65264.1    GEZM01014356    JAV92133.1    GEDV01003323    JAP85234.1    GBHO01031997    JAG11607.1    GEHC01000976    JAV46669.1    JYDN01000181    KRX54109.1    GEHC01000975    JAV46670.1    KL363340    KFD47113.1    KL367515    KFD67420.1    JYDW01000348    KRZ48953.1    KL363326    KFD47456.1    JYDL01000080    KRX17894.1    GGMR01001051    MBY13670.1    JYDO01000284    KRZ65891.1    KL367520    KFD66862.1    KL363212    KFD53932.1    JYDN01000036    KRX62850.1    JYDH01000010    KRY40903.1    KL367649    KFD60777.1   
Pfam
PF00078   RVT_1        + More
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
PF00378   ECH_1
PF17917   RT_RNaseH
PF03732   Retrotrans_gag
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF05485   THAP
PF00077   RVP
PF07727   RVT_2
PF13976   gag_pre-integrs
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR001753   Enoyl-CoA_hydra/iso       
IPR029045   ClpP/crotonase-like_dom_sf       
IPR041373   RT_RNaseH       
IPR005162   Retrotrans_gag_dom       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR034128   K02A2.6-like       
IPR006612   THAP_Znf       
IPR018061   Retropepsins       
IPR009068   S15_NS1_RNA-bd       
IPR013103   RVT_2       
IPR025724   GAG-pre-integrase_dom       
IPR008936   Rho_GTPase_activation_prot       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF52096   SSF52096       
SSF52540   SSF52540       
SSF48371   SSF48371       
SSF47060   SSF47060       
SSF48350   SSF48350       
Gene 3D
PDB
4OL8     E-value=2.46979e-18,     Score=228

Ontologies

Topology

Length:
671
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00022
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  671
 
 

Population Genetic Test Statistics

Pi
4.333924
Theta
6.889869
Tajima's D
-1.364791
CLR
109.099853
CSRT
0.0736463176841158
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号