SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11151  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008581
Annotation
PREDICTED:_fatty_acid_synthase-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.09 PlasmaMembrane   Reliability : 1.498
 

Sequence

CDS
ATGTTGACAACGTACACTCGAGGCTTAGTGTGTACCCAATCGCCGCTCATCGATGGATCTATGGCCGCCGTTGGACTTGGATATCAAAGCATTGCCAGACAATGTCCACCAGAAATAGATATTGCCTGTCACAACAGTTTCGAATCTACTACAATATCAGGACCGGCGGAAGTTACAAAATTATTCGTTGATGATCTAAAAAAACGTGGTATTTTTGCAAAAGAAGTCCCATGTGGAAACGTTGCCTTCCATTCCAGATATATTGCCTTGGCAGGACAAGCACTTTTAGATGCCTTGAAGAAAATTATTAAAGAACCTAAGCCTCGTAACGAGAAATGGTTGTCCACGTCCGTGCCACAACACAAATGGCACGAATTATCGGCAAAGTATTCTTCTCCTGAATACCATACCAATAACATGCTAAGTCCAGTTCTTTTCGAAGAAGTCACAAGGTTAATACCAGACAATGCTATTGTAATAGAAATAGCGCCTCACGGACTTCTCCAAGCCATTCTTAAGAGATCTTTGCAGAACTGTTTGCATATTCCACTGACAAAACGCGGAACGAATGACAGTGTTCAATTTTTGTTGGATGCGTTTGGCAAGATGTTTGAAGCAGGTTTAAATCCGAAAATTGAGAAGTTGTATCCTAAGATAGAGTTTCCAGTTTCGACTCAAACTCCTCTTTTGTCCAATTTAATTGAATGGGAACACAGTGAGGATTGGCTCCATTTGTTTTCCGGTTCCGGAGTAAAATGCACGGCAATCGCTCGAGATGTTGTCATTTCTTTTTACAACGATGATTACAACTTTTTGAAAGGACATTTGAGGAATGGACTAAACATATTACCTGAAGCTGAAATATTAGTTCTGGTTTGGGAAACAATGGCCATGTACAAGAATATGGATTACAGATACCTTTCTGTGATGTTTAAAGACGTACATTTTCATAGGGAAGTCGAGATTAAGCGTGATATCCCGTTAAGATTATCTATAAGTATAACGAAAGGAAACAATAGATTTGAGGTCATTCACGAAGACGCGATAGTGGTATGTGGAATTTTTGATGAGAGCGTCATTATGAAATCCGACCATGGTATAGATGAAACCAAATTTAACAAAGACGAAATTTTACTTAATACTGAAGATATTTACCAGATTCTAGAGCTACGAGGACACTGCTATACAGGTGAACACAAATCTATAGCATCAACGAACTTAGAACGGAATAAGGCGATAGTGCGGTGGAACAATAATTGGGCCTTATATCTGGATTCACTCATACAACTGAACATATTGGCTAATGAACACGAGGGCTTGTCAGTACCGAAATTTATTGGAAAAATAGCAATCAGTGTGTCTGAACATGAAAAAGCGATGCAAAAAGTCAATAATTTAACTGATGGTCATGTAGCCAACATTATCGATACATTTGATGTGACAAGGTGTGCAGGAGTTGAGATAGACCGTTTAATTTTCACCGAGAAAGCAGTCATTAACAAAGAGGCAGACGGCCTACAAATATTATCATTCTGTCCACAATATCCAACCGAGGAAATTAGTTTACAGCGAGCTATCAATGTGGTTTTAAAGATAGTAGCAGAAAATTCGTCTTCAAAAAAAATTAAAATAATTAAATCAGCCTCCTTAAGTATCGATGCATCTGATACTATTGAGAAAATAATTCAGACTGAACCGATGGAGGTAGAAGTTGTTACAGCAAACATCGACAATTTTCACAAAAAGAGTAATGGCATTAATGATGAACTAGCTGAAGTCAACTTAGTGATTATTGATAATATTTTGAATGATAAACAGAAGTTAGCAAAAATACACGAAACAATCTCAAAGGATACATTCATATTGACATTCGAAGCGAATGTACAAAAAAATAATCTAATTAAGAATTATTTTAACATAATAACGTGCATGTCAAGTGAAAATGGAATATGTATACTTCTGAAGAGAATTCCTCTAGAACGAGTTCAGCGTACATGTATACCAATTAACTATAAAACATATAAAGAACATTTGCTGTACGTGTATGAAGAATTGAAAAGGACAAGCGTAGTCTTGGTATCAGAGGGACAAAGCCTTTGCGGTATTTCAGGACTGGTAAAAAAATTAAGAAGAGATGGGCATAAAAATATATCTGCCATGATTATAGAGGATACTGATGCACCAAAGTTTAACCCTGACCATCCATTTTACAAAAGTCAGTTGGATTTGGATTTAGCTGCCAATGTTTTAAGAAAGCGGCAATGGGGAGGCTACTACTACATACCAAGTCAGATGTCAGCAAGCGTTCGTAACATGACCCTAATGAGCAAACAGCCTGGCAGCATTGATGGGTTGACGTGGGTTGAAGCTCCAGCTACAACAGATGGTGCTGAACATGTTCAGGTTTGGTACGCAGGGCTGTCACTAAAAGATTGCCAGAAGGCTATTAGTTGTGAGAATAACAACAGATCGTATTTCGGAATGGACTTCAGTGGCTATAATTCAAAAGGGGAGAAAATAATGGGTTTGGTACGCGAAGGGTCGTTGTCTAGTTCAGTGGAAGCTGATCCAGATCTAACGTGGTCAGTACCTGAACACTGGACGCTTGAAGAGGCAGCCACCGTTCCCCTAGCGTACCTTCATGCCTTCTATTGCTTGGAACTAAGGTGCGATATTTCTAGTGGAAAAACAGTATTCATCACAGGAGGGGCTGGGGCTCTAGGACAAGCAGTCATCTCCATATGCCTGGCTATGAACTGTCCTATTTATACAACCGTGAGAGATATTCATAAGAAAAACTTTTTATTAAAGCTGTTCCCTGAACTTCCAGAAAGTCACATTGGAATTTCCCACCTTGAAGCTTTATATAGCATGCTCATATTTAATTCTGAGAATAAACTTTGCGATATAATTATAAATTCAGACAGTGGTCATCTACGAGAGTGCTTGTTGAAATGTGTCAAGGCGAGTGGCACATTTTTGGACATAAGCAAATCAGACATGAACGAAAACAAAGATTTCTGCATGGGGTTTATTCGAGGCAACAGATCGTATAAGGCTGCTGATTTATCTAACATTTTTAAGCCCGAATTCATTGAAGACAAAAAGATTTTACGAAACATGATAGCTCAAGGTATTGCAAAAGGTATTGTTAAGCCCTTAACTAGAGTTGTATATCCAACTATAGCAATTACGAAAGCCTTTAAACTTTTATCATCGAGTAAACACAAAGGAAAGGTTTTAGTTCAAATGAAGGACCCCAGCTTCAAAATTGAACACAACATCCCTCCAAGAATGAAATATTTACCAAATGCAGTTTATATAGTCGTCTGTGATGATAGCTATTTGGGTATTGAGTTTACTGATGATATTATCAAAAAGGGAGCCAGAAAAGTCACGGTCAATATGAATAATGAAATATCTGGATATGTTTATTCAAAATTAATGTCTTGGAAGAAGCATGCTGCAGCAGTCAACATTACTTCATATTGCTTAAATACCAAAGAAGGATGTACTCAACTGCTTAAGGATAGTGCCAAAATCGGACAAGTAAAAGGAGTATACATAGTTAGTGATTCAGAAAGAAGGGAAAAAGAAAACAATATTGAATTACTCGTGTCTAATATGGACGTTGTTTCCAGAAGTATTTGTAATGGACTAAGTAATTTCGTGTTGATCTCGAAGTATTCCCAAAGTGACACTTACGAATATCAAATGGGAACCGTTGAGAAAATATTTGAAGCGCGAAATGAAATGGCCCTAACAAGTCTAGTTGTACGCTACGACGGACTGGACACATTCACAGATGTTTCCCAAAACACGACTGAGATACACAGGTCGACATTATTTGATGCAGTGGAAAAGAGCATCAGATTAAACCATCAAAACGTATACGTCTACAAATTGAGAAACAAAAAACCTTCGGACTACCATCAGATGATCTCTAAAATACTTGGCATAAAAACTTTGGATGGTGCTGATGATACACACTTGATAAGTGACTTCAAATTGAATGAAATCAGTCTGACGGAGATGAAAAATTTAATAATGAATTATTTTAAAGTTGACTTTCCTGTTGAACAAATACTGTCAATGAGTCTTGAAAGTTTAAAAGATCTTGGTAAAAACAAAAAAAAACCGGACATCAATTTCAATAGTGGATTAGGAGCTTTCATTGCATGTGTCGACGATGAAGAGACACATGTTACTATGCCACATAATATTGTTTCTATGAAGACATTGCTTAATAAGAGTATTGAGAGTGATATCGACCCCGAAAATACCTTCATAACCTTGATCCCAGGGTTCGAAGGTCGTCACCAAATATTCGAAACTCTAGCTGAAACATTAAAAGTTAAAGCAGTTGCCGTGCATTTGAGTTCAGTCATAACTATGGATAGTATACCACAAATGGCTGTAGAAATTCGTAAGCTGATGAAAATGAAATTCAAAGTGAAACCAAAGTTCCACCTACTTGGGTATTCGTTTGGAGTTAATATTACTTTGGAATTAGCTGCAATTTTGGAAAAAGAAGGCCACATCGGAACTGTTTACTGTTTAGATAGCAGCCCGGATGCATTACGAGATCAATTAGAAGCCTACCTGGGCAATCCAGACGAAAAGGAACTCCAAAACTACATAATAAACTACATATACCAACTACTTACTAACCAGAATAGCCAATTAGAAAATACCCTATCAACACTAGATACTTGGGAAGAAAAACTCCATATCAGCACAAAAGAAATCAAAAAATATTCGAGCTTTTCTTACGAATACATAAGGGCTATTGTTGATGGTGCGTACAAAAGAATTGAACTTGCTAAAAATTACAAGCCTGATATAATTTTGGAATCCGAATTGGTTCTCATTAAAGGAGTACCTCATCCATCTTCAAGATTATTACCCGATGATTACAATTTGTCGAAGTACAGCAGTAAGCCTGTGAAAGTATACCAAATCGATACTGACCATTCGCTGGCCACTTATGATTGTAGAGTTTCTAATATTATCAATTCTCTTCTTGAAAATACTCTACTAGAAGATTACAAGAAAAATGATCTTTGCGATGTATACATGACTTGA
Protein
MLTTYTRGLVCTQSPLIDGSMAAVGLGYQSIARQCPPEIDIACHNSFESTTISGPAEVTKLFVDDLKKRGIFAKEVPCGNVAFHSRYIALAGQALLDALKKIIKEPKPRNEKWLSTSVPQHKWHELSAKYSSPEYHTNNMLSPVLFEEVTRLIPDNAIVIEIAPHGLLQAILKRSLQNCLHIPLTKRGTNDSVQFLLDAFGKMFEAGLNPKIEKLYPKIEFPVSTQTPLLSNLIEWEHSEDWLHLFSGSGVKCTAIARDVVISFYNDDYNFLKGHLRNGLNILPEAEILVLVWETMAMYKNMDYRYLSVMFKDVHFHREVEIKRDIPLRLSISITKGNNRFEVIHEDAIVVCGIFDESVIMKSDHGIDETKFNKDEILLNTEDIYQILELRGHCYTGEHKSIASTNLERNKAIVRWNNNWALYLDSLIQLNILANEHEGLSVPKFIGKIAISVSEHEKAMQKVNNLTDGHVANIIDTFDVTRCAGVEIDRLIFTEKAVINKEADGLQILSFCPQYPTEEISLQRAINVVLKIVAENSSSKKIKIIKSASLSIDASDTIEKIIQTEPMEVEVVTANIDNFHKKSNGINDELAEVNLVIIDNILNDKQKLAKIHETISKDTFILTFEANVQKNNLIKNYFNIITCMSSENGICILLKRIPLERVQRTCIPINYKTYKEHLLYVYEELKRTSVVLVSEGQSLCGISGLVKKLRRDGHKNISAMIIEDTDAPKFNPDHPFYKSQLDLDLAANVLRKRQWGGYYYIPSQMSASVRNMTLMSKQPGSIDGLTWVEAPATTDGAEHVQVWYAGLSLKDCQKAISCENNNRSYFGMDFSGYNSKGEKIMGLVREGSLSSSVEADPDLTWSVPEHWTLEEAATVPLAYLHAFYCLELRCDISSGKTVFITGGAGALGQAVISICLAMNCPIYTTVRDIHKKNFLLKLFPELPESHIGISHLEALYSMLIFNSENKLCDIIINSDSGHLRECLLKCVKASGTFLDISKSDMNENKDFCMGFIRGNRSYKAADLSNIFKPEFIEDKKILRNMIAQGIAKGIVKPLTRVVYPTIAITKAFKLLSSSKHKGKVLVQMKDPSFKIEHNIPPRMKYLPNAVYIVVCDDSYLGIEFTDDIIKKGARKVTVNMNNEISGYVYSKLMSWKKHAAAVNITSYCLNTKEGCTQLLKDSAKIGQVKGVYIVSDSERREKENNIELLVSNMDVVSRSICNGLSNFVLISKYSQSDTYEYQMGTVEKIFEARNEMALTSLVVRYDGLDTFTDVSQNTTEIHRSTLFDAVEKSIRLNHQNVYVYKLRNKKPSDYHQMISKILGIKTLDGADDTHLISDFKLNEISLTEMKNLIMNYFKVDFPVEQILSMSLESLKDLGKNKKKPDINFNSGLGAFIACVDDEETHVTMPHNIVSMKTLLNKSIESDIDPENTFITLIPGFEGRHQIFETLAETLKVKAVAVHLSSVITMDSIPQMAVEIRKLMKMKFKVKPKFHLLGYSFGVNITLELAAILEKEGHIGTVYCLDSSPDALRDQLEAYLGNPDEKELQNYIINYIYQLLTNQNSQLENTLSTLDTWEEKLHISTKEIKKYSSFSYEYIRAIVDGAYKRIELAKNYKPDIILESELVLIKGVPHPSSRLLPDDYNLSKYSSKPVKVYQIDTDHSLATYDCRVSNIINSLLENTLLEDYKKNDLCDVYMT

Summary

EMBL
U67866    AAB53257.1    RSAL01000068    RVE49259.1    BABH01033637    NWSH01000591    + More
PCG75472.1    ODYU01001294    SOQ37311.1    PCG75471.1    ODYU01012325    SOQ58579.1    NWSH01000156    PCG78967.1    KQ459602    KPI93194.1    PCG78966.1    KQ461178    KPJ07769.1    ODYU01001484    SOQ37744.1    ODYU01003708    SOQ42815.1    RSAL01000013    RVE53445.1    AGBW02007651    OWR55047.1    U67867    AAB53258.1    PCG78963.1    NWSH01003873    PCG65731.1    KQ459582    KPI99075.1    GECU01006695    JAT01012.1    KK107139    EZA57700.1    GEDC01024813    JAS12485.1    ODYU01006431    SOQ48269.1    NNAY01001760    OXU23005.1    CH477489    EAT40085.1    GL438820    EFN68400.1    DS231997    EDS30986.1    GFDL01004709    JAV30336.1    JXUM01076840    KQ562972    KXJ74732.1    LBMM01000911    KMQ97230.1    KQ976440    KYM86527.1    KQ414663    KOC65238.1    KQ982480    KYQ55999.1    ADTU01005072    ADTU01005073    ADTU01005074    ADTU01005075    UFQS01001117    UFQT01001117    SSX09070.1    SSX28981.1    AXCM01001692    KQ981856    KYN34617.1    ATLV01015783    ATLV01015784    KE525036    KFB40722.1    KQ977574    KYN01849.1    KK852680    KDR18643.1    PCG65733.1    KQ761246    OAD57941.1    GL888175    EGI66082.1    GL445739    EFN89136.1    CVRI01000051    CRK99509.1    CH964272    EDW84866.1    CH940650    EDW67835.2    AXCN02000191    CRK99510.1    APCN01002072    AAAB01008987    EAA01044.4    CP012526    ALC46026.1    KQ460651    KPJ13003.1    GALX01004174    JAB64292.1    GECU01021338    JAS86368.1    CVRI01000038    CRK94451.1    OUUW01000014    SPP88346.1    KQ434960    KZC12654.1    UFQT01003008    SSX34421.1    CH954177    EDV60008.2    CH893166    KRK05689.1    KRK05688.1    OXU23004.1    KX467777    AOA60273.1    KX147671    ARI45075.1    KM507100    AKM28424.1    ABLF02036897    GAKP01015045    JAC43907.1    GAKP01015046    JAC43906.1    GDHF01026866    JAI25448.1    GBXI01000719    JAD13573.1    GBXI01003003    JAD11289.1    KA644718    AFP59347.1    NEVH01022635    PNF18741.1   
Pfam
PF14765   PS-DH        + More
PF02801   Ketoacyl-synt_C
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF00975   Thioesterase
PF00109   ketoacyl-synt
PF00107   ADH_zinc_N
PF08659   KR
PF00550   PP-binding
Interpro
IPR018201   Ketoacyl_synth_AS        + More
IPR001031   Thioesterase       
IPR014043   Acyl_transferase       
IPR036291   NAD(P)-bd_dom_sf       
IPR032821   KAsynt_C_assoc       
IPR042104   PKS_dehydratase_sf       
IPR011032   GroES-like_sf       
IPR014031   Ketoacyl_synth_C       
IPR023102   Fatty_acid_synthase_dom_2       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR020807   PKS_dehydratase       
IPR001227   Ac_transferase_dom_sf       
IPR029058   AB_hydrolase       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR020801   PKS_acyl_transferase       
IPR016039   Thiolase-like       
IPR014030   Ketoacyl_synth_N       
IPR020843   PKS_ER       
IPR013149   ADH_C       
IPR013968   PKS_KR       
IPR036736   ACP-like_sf       
IPR020806   PKS_PP-bd       
IPR009081   PP-bd_ACP       
IPR006162   Ppantetheine_attach_site       
SUPFAM
SSF50129   SSF50129        + More
SSF55048   SSF55048       
SSF53901   SSF53901       
SSF53474   SSF53474       
SSF52151   SSF52151       
SSF51735   SSF51735       
SSF47336   SSF47336       
PDB
6FN6     E-value=1.37823e-80,     Score=769

Ontologies

Topology

Length:
1694
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.20284
Exp number, first 60 AAs:
0.02346
Total prob of N-in:
0.00175
outside
1  -  1694
 
 

Population Genetic Test Statistics

Pi
19.556474
Theta
20.967769
Tajima's D
-0.918602
CLR
14.452658
CSRT
0.150192490375481
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号