SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11150
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.423 Peroxisomal   Reliability : 1.442
 

Sequence

CDS
ATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATTGTTGCGGCACTCTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCACCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCTCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCAGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGTGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAACAATACGGCTTCAGAGAGGGCCGCTCGACGATAGACGCAATTCTGCGCGTGCGTGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGTCGACTGATCGGCTACTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCTGTCCTGGGCCCCCTGCTATGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCGTACGGGGTCCCCTCCCCGGGCTGAGCGTAATTTGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTAGTCACAAGGATCCGACGGCTGGGACTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTGTTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTTGAACTGGATGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGACTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGGGCTCCCGTATGCGCGCGCTGCCGTGGAGTGAATAGAGCGACCGGTCGACGGTGTATCGCGTCCCGACCCGGCAGGCTGGTTCTGGTCCAGCGGGGTATTCCGGGACACCAGCGGCACCGTCTGGGCGGCCCGACGGGCTGCCGTACCGAGACGGCCGACGTTTCAGAGCCTTCGATCCGCCTCGAAGGCTCCGTCGGCTGGGCGTCCTTGGGGTGA
Protein
MKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVAALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAALGPDGVHGRVWSLAFEALGDRLRGLFEACLESGRFPSKWKTGRLVLLRKDGCPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGYYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVVRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVCARCRGVNRATGRRCIASRPGRLVLVQRGIPGHQRHRLGGPTGCRTETADVSEPSIRLEGSVGWASLG

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
EMBL
AB090825    BAC57926.1    AB078929    BAC06452.1    AB078931    BAC06456.1    + More
AB078936    BAC06464.1    AB078930    BAC06454.1    AB078935    BAC06462.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ149896    PZC78733.1    LBMM01015565    KMQ84759.1    KQ460685    KPJ12887.1    AGBW02011529    OWR46521.1    LBMM01006994    KMQ90132.1    LBMM01008448    KMQ88867.1    LBMM01006671    KMQ90407.1    LBMM01003575    KMQ93366.1    LBMM01008422    KMQ88894.1    LBMM01005948    KMQ91066.1    LBMM01008445    KMQ88871.1    LBMM01003988    KMQ92922.1    LBMM01004262    KMQ92649.1    LBMM01009535    KMQ88053.1    LBMM01004272    KMQ92618.1    LBMM01006954    KMQ90166.1    LBMM01004261    KMQ92650.1    LBMM01002052    KMQ95336.1    LBMM01007036    KMQ90099.1    LBMM01015018    KMQ84954.1    LBMM01007425    KMQ89740.1    LBMM01002480    KMQ94776.1    LBMM01006657    KMQ90417.1    LBMM01012412    KMQ86235.1    LBMM01006063    KMQ90967.1    LBMM01015285    KMQ84870.1    LBMM01014122    KMQ85315.1    LBMM01015025    KMQ84953.1    LBMM01004634    KMQ92224.1    GGMR01000779    MBY13398.1    LBMM01008278    KMQ89009.1    LBMM01005474    KMQ91485.1    LBMM01004505    KMQ92346.1    LBMM01004312    KMQ92579.1    GGMR01015159    MBY27778.1    GGMR01014195    MBY26814.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02011238    LBMM01007162    KMQ89978.1    LBMM01008086    KMQ89159.1    QOIP01000014    RLU15074.1    LBMM01008226    KMQ89040.1    LBMM01005733    KMQ91252.1    ABLF02023257    LBMM01006977    KMQ90149.1    LBMM01009610    KMQ87992.1    GDAI01000741    JAI16862.1    ABLF02011136    ABLF02014426    KQ972226    KYB24577.1    LBMM01013668    KMQ85535.1    LBMM01009093    KMQ88396.1    ABLF02014378    GAKP01002292    JAC56660.1    LBMM01006996    KMQ90130.1    KQ971309    EEZ99146.1    GGFJ01001165    MBW50306.1    ABLF02034925    GGFJ01001164    MBW50305.1    KU543683    AMS38371.1    ABLF02014650    GGFM01001733    MBW22484.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGMR01008673    MBY21292.1    GGFJ01001166    MBW50307.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF00098   zf-CCHC
PF00151   Lipase
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029058   AB_hydrolase       
IPR013818   Lipase/vitellogenin       
IPR000734   TAG_lipase       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53474   SSF53474       
Gene 3D
PDB
6AR3     E-value=0.000302564,     Score=106

Ontologies

Topology

Subcellular location
Secreted  
Length:
532
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.834709999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00077
outside
1  -  532
 
 

Population Genetic Test Statistics

Pi
1.599839
Theta
4.316161
Tajima's D
-0.998098
CLR
87.270486
CSRT
0.132343382830858
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号