SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11148
Pre Gene Modal
BGIBMGA008582
Annotation
PREDICTED:_fatty_acid_synthase-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.354 Nuclear   Reliability : 2.126
 

Sequence

CDS
ATGAAAGAAGTACATTATTCTACTACTAAAAGCATCAAAACTTTAGATGGTGCTGATGATACGCACTTGATAAGTGACTTCAAATTGAATGAAATCCGTCTGTTGGAGCTGAAAAACTTAATAATGAATTATTTTAAAGTTGACTTCCCTGTTAAACAAATACAATCAATGAGTCTTGAAAGTTTAAAAGATCTTGGTAAAATCAAGAAAAAGCCGGATACTAATTTTAATAGTGGATTAGGAGCTTTCATTGCATGTGTTGACGATGAAGAAACCCATGTTACTATGTCGCATAATATTGTTTCTATGAAGACATTGCTTAATAAGAGTATTGAGAATGATCTCGACCCCGAAAATACCTTCATAACCTTGATCCCAGGGTTCGAAGGTCGTCACCAAATATTCGAAACTCTAGCTGAAACATTAAAGGTTAAAGCAGTTGCCGTGCATTTAAGTTCAGACATAGCTATGGATAGTTTGCCAGAAATTGCTGCCCAAGTTTGCAAGCTGATGAAAACGAAGTTCAAAGTGAAATCAAAGTTCTATCTACTCGGTTATTCATTTGGAGTTAATATTGCTTTAGAATTGGCTGCAATTTTGGAAAAAGAAGGTCACGTTGGAACTGTTTACTGTTTAGATAGCAGCCCGGATGTATTACGAGATCAATTAGGAGCTTACCTGGGTAATCCAGACGAAAATGAACTCCAAAACAATGTAATAGAACACATATACCAACTACTTACTAACCAAAACAGCCAATTAGGAAATATCCTATCAACAGCAGACACTTGGGAAGAAAAACTCCATATTGGCACAAAAGAAATCAAAAAGTATTCGGCTTTTTCTCACGAATACATAAGATCTATTGTTGATGACACCTATAAAAGAATTGAACTTGCTAAAAATTATAAACCTGATATAATTTTAGCATCCGAATTGGTTCTCATTAAAGGAGTACCTCATCCATCTTCAAGATTACTGCCCGATGATTACAATTTGTCGAAGTACAGCAGTAAGCCTGTGAAAGTATACCAAATCGATATTGACCATTCGCTGGCCACTTATGATTGTAGAGTTTCTAATATCATCAATTCTCTTCTTGAAAATACTCTACTAGAAGAGTACAAGAAAAATAATCTTTGCGACGTATACTTCATGTAA
Protein
MKEVHYSTTKSIKTLDGADDTHLISDFKLNEIRLLELKNLIMNYFKVDFPVKQIQSMSLESLKDLGKIKKKPDTNFNSGLGAFIACVDDEETHVTMSHNIVSMKTLLNKSIENDLDPENTFITLIPGFEGRHQIFETLAETLKVKAVAVHLSSDIAMDSLPEIAAQVCKLMKTKFKVKSKFYLLGYSFGVNIALELAAILEKEGHVGTVYCLDSSPDVLRDQLGAYLGNPDENELQNNVIEHIYQLLTNQNSQLGNILSTADTWEEKLHIGTKEIKKYSAFSHEYIRSIVDDTYKRIELAKNYKPDIILASELVLIKGVPHPSSRLLPDDYNLSKYSSKPVKVYQIDIDHSLATYDCRVSNIINSLLENTLLEEYKKNNLCDVYFM

Summary

EMBL
BABH01033622    BABH01033623    BABH01033624    BABH01033612    BABH01033613    ODYU01001294    + More
SOQ37311.1    NWSH01000591    PCG75470.1    ODYU01012325    SOQ58579.1    PCG75471.1    U67866    AAB53257.1    BABH01033637    PCG75472.1    JTDY01000529    KOB76790.1    RSAL01000068    RVE49259.1    KOB76788.1    JTDY01004048    KOB68669.1    KQ461073    KPJ09499.1    KQ459053    KPJ04123.1    KPJ04122.1    KPJ04124.1    GEYN01000117    JAV02012.1    KQ461178    KPJ07769.1    JTDY01003650    KOB69211.1    NWSH01000156    PCG78967.1    KQ459602    KPI93194.1    PCG78966.1    PCG78964.1    PCG78965.1    JTDY01003263    KOB69848.1    AGBW02013713    OWR42929.1    JTDY01003390    KOB69632.1    BABH01041756    BABH01022901    BABH01022902    PCG78963.1    AK403251    BAM19658.1    BABH01022891    KQ459582    KPI99075.1    KQ460651    KPJ13005.1    BABH01003987    BABH01003988    U67867    AAB53258.1    NWSH01003873    PCG65731.1    AGBW02007651    OWR55047.1    GECZ01008485    JAS61284.1    ODYU01010623    SOQ55856.1    DS235784    EEB16951.1    GECU01006695    JAT01012.1    NEVH01025646    PNF15226.1    PNF15228.1    GEBQ01031053    JAT08924.1    GGMS01017661    MBY86864.1    NNAY01001760    OXU23002.1    OUUW01000014    SPP88346.1    KM507100    AKM28424.1    GGMR01004548    MBY17167.1    CH933806    EDW14645.2    CM000361    EDX03569.1    ABLF02036897    CM000070    EDY68457.3    GBYB01001605    JAG71372.1    GEDC01024813    JAS12485.1    CP012526    ALC46026.1    CM002910    KMY87820.1    AE014134    AAF51148.1    AF145643    AAD38618.1    ACL82985.2    CH954177    EDV60008.2    KQ414663    KOC65238.1    CH893166    KRK05688.1    KRK05689.1    CH902620    EDV31744.2    CH964272    EDW84866.1    CH480820    EDW54099.1    GBXI01000719    JAD13573.1    GBXI01003003    JAD11289.1    CH916368    EDW02935.1    CM000157    EDW87493.2    ODYU01002245    SOQ39471.1    KQ982480    KYQ55999.1   
Pfam
PF07690   MFS_1        + More
PF02801   Ketoacyl-synt_C
PF00698   Acyl_transf_1
PF00109   ketoacyl-synt
PF00975   Thioesterase
PF08659   KR
PF16197   KAsynt_C_assoc
PF14765   PS-DH
PF00107   ADH_zinc_N
PF00550   PP-binding
Interpro
IPR020841   PKS_Beta-ketoAc_synthase_dom        + More
IPR020846   MFS_dom       
IPR001227   Ac_transferase_dom_sf       
IPR036259   MFS_trans_sf       
IPR020843   PKS_ER       
IPR014030   Ketoacyl_synth_N       
IPR016039   Thiolase-like       
IPR020801   PKS_acyl_transferase       
IPR011701   MFS       
IPR042104   PKS_dehydratase_sf       
IPR011032   GroES-like_sf       
IPR036291   NAD(P)-bd_dom_sf       
IPR014043   Acyl_transferase       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR014031   Ketoacyl_synth_C       
IPR001031   Thioesterase       
IPR023102   Fatty_acid_synthase_dom_2       
IPR029058   AB_hydrolase       
IPR013968   PKS_KR       
IPR018201   Ketoacyl_synth_AS       
IPR032821   KAsynt_C_assoc       
IPR020807   PKS_dehydratase       
IPR013149   ADH_C       
IPR036736   ACP-like_sf       
IPR020806   PKS_PP-bd       
IPR009081   PP-bd_ACP       
IPR006162   Ppantetheine_attach_site       
SUPFAM
SSF103473   SSF103473        + More
SSF55048   SSF55048       
SSF50129   SSF50129       
SSF53901   SSF53901       
SSF51735   SSF51735       
SSF52151   SSF52151       
SSF53474   SSF53474       
SSF47336   SSF47336       
PDB
3TJM     E-value=8.33649e-06,     Score=118

Ontologies

Topology

Length:
386
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
13.56877
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.70209
inside
1  -  180
TMhelix
181  -  200
outside
201  -  386
 
 

Population Genetic Test Statistics

Pi
19.599414
Theta
22.827783
Tajima's D
-0.951708
CLR
2.389799
CSRT
0.146492675366232
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号