SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11145  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008579
Annotation
PREDICTED:_fatty_acid_synthase-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.327 Mitochondrial   Reliability : 1.27
 

Sequence

CDS
ATGGGACACGCAGATGCTGCTTCGGGTATCTGCGGTATCACTAAGCTATGCCTTGCATACCATCAAGGGAAACTTGCCCCAAATTTACATTACAATGAACCTCAAGACCTGGCGGCTATTAGAGATGAAAGAGTTCAAGTAGTAACAGAGCCCACACCTTTCAGTCGAGGTTACACGGCACTTAACAACTTTTCTTACAACGGAGTTGATTGTCATCTTCTATTAAAAGGACATTTTAAGGAAAAGGATCCACAGAAATACAGATTGAATATTCCTTACCTGATCCTCGCATCGGGAAGGCAAGATGAATCTGTGCAGAAAATTTTAGATCTACTCAAAAAGCATCCACTAGATCCAGAACAAATAGCTTTACTGCATAGCGCTTTCGAACATGATATATTTGGTCATACTAGTCGAGGCTATACAATATTAGATACAAACAGTAAGAACGAGATAATTCCACTCAAAGAAAGTGTTGAATATTATGCTGGACTCAAAAGGCCTGTTTGGTTTGTGTTCAGCGGTATGGGTTCTCAATGGACGGGAATGGGAGCTGATTTAATGAAAATAAATACTTTTGCTGCAGCCATTGAAAAATGTCGAAAAGTTTTAGAGCCAAAGAACATAGACATTGTCAAAATTATAACTGGAGGAGATAAAAGTTTGTTAGAAAGTACACTGAATTCGTTCGTTGGCATTGCAGCTGTTCAAGCCGGCCTCATTGATATAATTAAAGAACTGGGTATTGTCCCGGATTACATATTTGGTAAGTTTTAA
Protein
MGHADAASGICGITKLCLAYHQGKLAPNLHYNEPQDLAAIRDERVQVVTEPTPFSRGYTALNNFSYNGVDCHLLLKGHFKEKDPQKYRLNIPYLILASGRQDESVQKILDLLKKHPLDPEQIALLHSAFEHDIFGHTSRGYTILDTNSKNEIIPLKESVEYYAGLKRPVWFVFSGMGSQWTGMGADLMKINTFAAAIEKCRKVLEPKNIDIVKIITGGDKSLLESTLNSFVGIAAVQAGLIDIIKELGIVPDYIFGKF

Summary

EMBL
NWSH01005017    PCG64490.1    ODYU01012610    SOQ59025.1    ODYU01007677    SOQ50673.1    + More
BABH01033637    U67866    AAB53257.1    NWSH01000591    PCG75471.1    RSAL01000068    RVE49259.1    PCG75472.1    JTDY01000529    KOB76786.1    JTDY01002046    KOB72242.1    NWSH01000156    PCG78967.1    ODYU01009787    SOQ54442.1    BABH01022903    AGBW02011888    OWR45966.1    PCG78966.1    KQ461178    KPJ07769.1    KQ459602    KPI93194.1    KOB76787.1    RSAL01000013    RVE53442.1    RVE53445.1    PCG78963.1    JTDY01003650    KOB69211.1    JTDY01003335    KOB69710.1    JTDY01003263    KOB69848.1    KQ461073    KPJ09498.1    PCG78965.1    KQ459053    KPJ04124.1    KPJ04123.1    KZ150116    PZC73268.1    KPJ04122.1    JTDY01000102    KOB78858.1    JTDY01003390    KOB69631.1    NWSH01003873    PCG65733.1    PCG65731.1    ODYU01000212    SOQ34605.1    RSAL01000071    RVE49124.1    U67867    AAB53258.1    GL438820    EFN68400.1    KQ459582    KPI99075.1    ODYU01002244    SOQ39469.1    GL765434    EFZ16301.1    KQ460651    KPJ13003.1    BABH01003986    GL888175    EGI66082.1    KQ977574    KYN01849.1    KQ460598    KPJ13817.1    AGBW02007651    OWR55047.1    ADTU01005072    ADTU01005073    ADTU01005074    ADTU01005075    GBYB01008708    JAG78475.1    KQ976440    KYM86527.1    GEDC01024813    JAS12485.1    KQ981856    KYN34617.1    LBMM01000911    KMQ97230.1    KK107139    EZA57700.1    GL445739    EFN89136.1    NNAY01001760    OXU23004.1    KQ978607    KYN29892.1    ODYU01011246    SOQ56864.1    GECU01021338    JAS86368.1    GECU01006695    JAT01012.1    GECZ01010430    JAS59339.1    GEBQ01017893    JAT22084.1    KQ435885    KOX69550.1    NNAY01001038    OXU25389.1    KQ982480    KYQ55999.1    KQ434960    KZC12654.1    GECZ01016812    JAS52957.1    GEBQ01010560    JAT29417.1    NEVH01025646    PNF15229.1    KQ414663    KOC65238.1    CP012526    ALC46026.1    NEVH01006580    PNF37601.1    UFQT01000602    SSX25625.1    PYGN01002008    PSN31835.1    KQ761246    OAD57941.1    CCAG010001609    NNAY01001061    OXU25291.1    KQ977412    KYN02883.1    KK852983    KDR12868.1    GEDC01016862    GEDC01012243    JAS20436.1    JAS25055.1    GEDC01031722    GEDC01008387    JAS05576.1    JAS28911.1    GEDC01031101    GEDC01028079    GEDC01018856    GEDC01013285    JAS06197.1    JAS09219.1    JAS18442.1    JAS24013.1    KK852680    KDR18643.1    GDHF01026736    JAI25578.1    NEVH01022635    PNF18741.1    CH893166    KRK05689.1    CCAG010017947    GDHF01029400    JAI22914.1    LNIX01000004    OXA55963.1   
Pfam
PF02801   Ketoacyl-synt_C        + More
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF00109   ketoacyl-synt
PF00975   Thioesterase
PF14765   PS-DH
PF00107   ADH_zinc_N
PF08659   KR
PF00550   PP-binding
Interpro
IPR014043   Acyl_transferase        + More
IPR036291   NAD(P)-bd_dom_sf       
IPR032821   KAsynt_C_assoc       
IPR042104   PKS_dehydratase_sf       
IPR011032   GroES-like_sf       
IPR014031   Ketoacyl_synth_C       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR001227   Ac_transferase_dom_sf       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR020801   PKS_acyl_transferase       
IPR016039   Thiolase-like       
IPR014030   Ketoacyl_synth_N       
IPR020843   PKS_ER       
IPR018201   Ketoacyl_synth_AS       
IPR020807   PKS_dehydratase       
IPR029058   AB_hydrolase       
IPR023102   Fatty_acid_synthase_dom_2       
IPR001031   Thioesterase       
IPR013149   ADH_C       
IPR013968   PKS_KR       
IPR036736   ACP-like_sf       
IPR009081   PP-bd_ACP       
IPR020806   PKS_PP-bd       
SUPFAM
SSF51735   SSF51735        + More
SSF52151   SSF52151       
SSF53901   SSF53901       
SSF55048   SSF55048       
SSF50129   SSF50129       
SSF53474   SSF53474       
SSF47336   SSF47336       
PDB
5MY2     E-value=4.95459e-41,     Score=420

Ontologies

Topology

Length:
258
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17638
Exp number, first 60 AAs:
0.00416
Total prob of N-in:
0.03338
outside
1  -  258
 
 

Population Genetic Test Statistics

Pi
30.005146
Theta
23.982524
Tajima's D
0.64546
CLR
0.430334
CSRT
0.56297185140743
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号