SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11130
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.277
 

Sequence

CDS
ATGAACACGAACAGCGCGCTATTCGCGCAGTTCGTGCAATTAATATGCCCGGACATTATGTCCCGTTTTGAGGCCTACAAGGCCACGCTAGAGTCGAACCCCGATGGTTCATCCGCCGCCGCCGCGATTATCATCCGCGACTCGCCGTTATCGCCTCCCGCGCCGGCACTCCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCCTCCGTCGCGGAGAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCGCCGCGAGTCCCCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAACCAAAGGCCGCGAACGCGTCGCGGCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAATCTTCTTGGGATCGCGTATCCCTGGCCCTTAAAGCCAACAAGATAAATGTAGTCCATGCGAGGAATATTCCGCATGGAATACAAATCAAAGTAGAGTCATCCGACGACCATAGGTCTTTGACAGCATACCTCCGCAAGGAACGCATAGGTTATCACACCTATGCGCTCCAGGAGGAGCGCGAACTCCGCGTCGTAGTACGCGGAGTCCCAAAAGAGCTCGACGTCGAGCAAATCAAAAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGCGTGCACCGGATGCACAGCGGGCGCGATAAATTCGCGTATGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAGTTATATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAATGTTTAGACGATCACGCGACCACCGATTGCTCGCGGGTAAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTATGCGCCGCAACCTCTACTCGCGCCGCGCCCCGCCCCCGCGCCCGCGCCCGGTCCTGCGCCTCGCCCCGGCCCCGCGCACTCAAACGATTTTACAATTATTCGCGACTACATCGCCGCGATAAACATCCACCGCATGCGTGCGTTCGCCGACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAGTACATCGACGTCATCGAGTCCGTCCAGCGCACGCTGCGCGACCAGGTTTATGAGTTTCTACGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGTACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTATATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCCGACACCGCTCTACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAATATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTTGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTGAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAAAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATCGTCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAACAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAACCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACGATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAATAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAATTATACGAACGGCTCCTTCGTAAACGCCTCTGGGATTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAATACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACTCACTTAAAGTCATTCCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCAATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCGCCCGATCCACTAACGGTGCTTTTAGGTAATTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MNTNSALFAQFVQLICPDIMSRFEAYKATLESNPDGSSAAAAIIIRDSPLSPPAPALRDSPMSPPTPAPASIASSVAESSGSDSESEMEYESAASPQPGTSEGFTTVARGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPGPAPVRKVPAPPPVILREKSSWDRVSLALKANKINVVHARNIPHGIQIKVESSDDHRSLTAYLRKERIGYHTYALQEERELRVVVRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPAPAPAPGPAPRPGPAHSNDFTIIRDYIAAINIHRMRAFADAMRRAVTAEDRLNATFEYIDVIESVQRTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTALPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIRLSPDLRDLVRVRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLKELAPTHQAYWRLARTLKSETIVTMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDNLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPNNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPNPADRMESSRRRPKHVISDPPDPLTVLLGNSSTGHRSRRTRRLRRRARRVN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00108876,     Score=105

Ontologies

GO

Topology

Length:
1453
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.484940000000001
Exp number, first 60 AAs:
0.00461
Total prob of N-in:
0.00025
outside
1  -  1453
 
 

Population Genetic Test Statistics

Pi
1.858871
Theta
1.21332
Tajima's D
0.920901
CLR
138.575057
CSRT
0.708614569271536
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号