SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11128
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 1.225
 

Sequence

CDS
ATGGCAACGGCGCAGGTCGCTGACGGCGGAGAGCTGGAAGGTGTGTCCCAGGCGGAATTTGAGGCGGCAGTGGCGAGGATGCGCGTGAAGCGTACAGCACCAGGCCCCGACGGCCTGTCGAGTCGAGCATGGGCTCTCGCTTTAACTGAGGATGGTTTGGGACCTGCACTTCGAACGCTGTTTAGCAGGTGCCTCCGCGAGGGCAGGTTCCCGGAGCCGTGGCGCACGGGCCGGCTGGTGCTTATCCCGAAGGACGGTCGCCCTAGAGACGAGCCCTCCGGATATCGCCCGATAGTAGTGTTGGACGAGGCCGGTAAGCTCCTTGAGCGTGTGGTTGCCGGGCGTCTTGTTCAGCACCTCGAGAACATTGGGCCGGATCTCGCGTCCAACCAATATGGCTTCCGGAGAGGTCGGTCGACCGTGGACGCGGTCTTACGGGTCCGCGATCTTTCCGACCAGGCGTGCTCTGGGGGAGGTGTACTGTTGGCTGTGTCGATTGATATTGCCAACGCCTTCAACACGATCCCCTGGAGCACGATTGTGGAGTCATTACGGTTTCACCGCGTCCCCACCGGTCTCCGTAATCTGATTGAGGATTATCTCTCAGGGCGGGCGGTGATCTTCCCCGAGCGGAGTGGGTGGGGACGAAAAACAGTGTCACGTGGGGTTCCACAAGGGTCGGTACTGGGTCCACTCCTTTGGAATATAGGCTTTGACTGGGTCCTCCGCGGGGCTAACCTGCCTGGCGTCGAAGTGGTTTGCTACGCTGACGACACGCTGGTGACGGCTTGCGGAGACGACTACCGGTCAGCAGCCGTCCTGGTTGTGGCTGCAGTGGCAACTGTGCCGAAGCTCAAGTATTTGGGCCTCGTGCTGGACAGCAAATGGAGATTCGACCACCATTTTAAGGCGCTGGTTCCGAGGCTTATGGGGGCGGCAGGTGCGCTGACCCGTCTTCTTCCCAACGTCGGAGGATGCAGCGCCGGTACTCGGCGACTGTACCTTGGGGTGGTGCGCAGTATGGCCCTGTACGGTGCTCCCGTGTGGTCGCCCGCACTCTCCGCGAGAAACGCGTCTCTGCTGCTCAGAGCTCAGCGGGCGCTCGCGGTGAGGGTCATCAGGGGGTACCGCACCATCTCTCAAGATGTGGCCTGCGCTCTCGCCGGATCCCTACCCTGGGACCTCGAGGCCGAAATCTTGGCTGCGGTATATCGGCGTAAGGCGCAGGCCTTGAGTCGGGGACGGTCGCCCGGCCCGTCGGCTGTCGGTCGGTGGAAGCGTGCTGCGCGTCATGTAGCATACGCTAAGTGGAGAGAGCGATTGCTGAAGGAACTTGGCCAAACTTCAGCCACCCGCCGTCGCACCCTCGAGGCCCTGGTGCCCGTGCTGGAGGCATGGTCGGAACGGCGTCACGGCGTACTCTCCTTTCACCTTGCGCAGGTCCTCTCGGGACATGGCTGTTTCGGGAGGTACCTGTGGAAGGTCTGCAGGAGGGAGCCACATCCGGGCTGCCACCAGTGCGGGCACCCGGACGATGACGCGCAGCACGCGCTCGAAACGTGCCCGCGTTGGGAGCACTCGCGGCGAGATCTCGTCGCGGTGCTGGGGAGAAACCTCTCCCTGCGGGCTGTCGTCGCCCGCATGTTAGAGGATCAGGGCTCGTGGGAGGCCATGGCCAGGTTTTGTGACCTGGTAATGGCGTCCCGTGAGGCTGAGGAGCGTGAAAGGGAGTGGGATCCCTCTTCAGCACCTCAGCGCAGAAGGCGGGATGGCCGGCGCGGGCGTGAAGCTCCCGCTCAGCCCCCGTAG
Protein
MATAQVADGGELEGVSQAEFEAAVARMRVKRTAPGPDGLSSRAWALALTEDGLGPALRTLFSRCLREGRFPEPWRTGRLVLIPKDGRPRDEPSGYRPIVVLDEAGKLLERVVAGRLVQHLENIGPDLASNQYGFRRGRSTVDAVLRVRDLSDQACSGGGVLLAVSIDIANAFNTIPWSTIVESLRFHRVPTGLRNLIEDYLSGRAVIFPERSGWGRKTVSRGVPQGSVLGPLLWNIGFDWVLRGANLPGVEVVCYADDTLVTACGDDYRSAAVLVVAAVATVPKLKYLGLVLDSKWRFDHHFKALVPRLMGAAGALTRLLPNVGGCSAGTRRLYLGVVRSMALYGAPVWSPALSARNASLLLRAQRALAVRVIRGYRTISQDVACALAGSLPWDLEAEILAAVYRRKAQALSRGRSPGPSAVGRWKRAARHVAYAKWRERLLKELGQTSATRRRTLEALVPVLEAWSERRHGVLSFHLAQVLSGHGCFGRYLWKVCRREPHPGCHQCGHPDDDAQHALETCPRWEHSRRDLVAVLGRNLSLRAVVARMLEDQGSWEAMARFCDLVMASREAEEREREWDPSSAPQRRRRDGRRGREAPAQPP

Summary

EMBL
D85594    BAA19776.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
AB078929    BAC06452.1    AB078935    BAC06462.1    AB090825    BAC57926.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    KQ460685    KPJ12887.1    RSAL01000481    RVE41577.1    LBMM01006954    KMQ90166.1    LBMM01002052    KMQ95336.1    LBMM01005733    KMQ91252.1    LBMM01006671    KMQ90407.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01008682    KMQ88705.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01003679    KMQ93242.1    LBMM01008448    KMQ88867.1    GAKP01002292    JAC56660.1    ABLF02011238    GEHC01000964    JAV46681.1    LBMM01004505    KMQ92346.1    LBMM01004634    KMQ92224.1    LBMM01006657    KMQ90417.1    LBMM01015018    KMQ84954.1    LBMM01006063    KMQ90967.1    LBMM01005465    KMQ91492.1    GGMR01000779    MBY13398.1    ABLF02059310    GGMR01006838    MBY19457.1    GGMR01004600    MBY17219.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01002480    KMQ94776.1    LBMM01014122    KMQ85315.1    LBMM01008422    KMQ88894.1    LBMM01015025    KMQ84953.1    KU543683    AMS38371.1    LBMM01007425    KMQ89740.1    KMQ94772.1    LBMM01003575    KMQ93366.1    KU543679    AMS38363.1    GALA01001777    JAA93075.1    LBMM01006110    KMQ90925.1    ABLF02041886    ABLF02011183    ABLF02041884    GGMR01014195    MBY26814.1    GALA01000302    JAA94550.1    ABLF02018942    ABLF02041885    LBMM01005948    KMQ91066.1    GFXV01002090    MBW13895.1    GALA01001776    JAA93076.1    LBMM01012412    KMQ86235.1    GAMC01020519    GAMC01020515    JAB86040.1    GFXV01003903    MBW15708.1    LBMM01008278    KMQ89009.1    GAMC01020517    JAB86038.1    LBMM01005474    KMQ91485.1    LBMM01003988    KMQ92922.1    ABLF02041557    ABLF02034925    ABLF02013358    ABLF02013361    ABLF02054869    GGFL01004044    MBW68222.1    AB593322    BAK38641.1    ABLF02014378    GGFJ01001453    MBW50594.1    GGFK01005660    MBW38981.1    GGMR01015159    MBY27778.1    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    ABLF02007989    GGFJ01001454    MBW50595.1    ABLF02016340    KQ971310    KYB29499.1    AB593325    BAK38646.1    ABLF02018808    KQ973256    KXZ75595.1    ABLF02021100    GGFJ01001369    MBW50510.1    GGFJ01001727    MBW50868.1    AB593326    BAK38647.1    GGFJ01001370    MBW50511.1    GGFL01001190    MBW65368.1    KQ972544    KXZ75869.1    AB090813    BAC57902.1    GGFL01001189    MBW65367.1    GGMR01019493    MBY32112.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF00098   zf-CCHC
PF13966   zf-RVT
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR000663   Natr_peptide       
IPR026960   RVT-Znf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=5.17522e-06,     Score=122

Ontologies

Topology

Length:
602
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.33939
Exp number, first 60 AAs:
0.00127
Total prob of N-in:
0.01045
outside
1  -  602
 
 

Population Genetic Test Statistics

Pi
13.424506
Theta
22.343046
Tajima's D
-1.946214
CLR
0
CSRT
0.0181490925453727
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号