SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11123
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 2.253
 

Sequence

CDS
ATGGCCAAAGTATTTAGATGCGTGGTTTGCTACGCTGACGACACGCTGGTGACGGCCCGCGGAGACGACTACCGGTCAGCAGCCATCCTGGCTGTAGCAGGTGTAGCGACTGTGGTGAGTCGAATAAAGAGACTCGGCCTCGAGGTGGCCCTTCATAAATCCGAAGCAGTGTGCTTCCACTCGGCTCGGGAGGGGCCGCCTCAAGGCGCGAATCTCGTAGTCGGTGGTGTCACCATTGCTGTCCAGCCGAAGCTCAAGTATTTGGGCCTTGTGTTGGACAGCAAATGGAGATTCGACCACCATTTCAAAATGCTGGTTCCAAGGCTGATGGGGACGGCGGGTGCGCTGACCCGTCTTCTTCCCAACACCGGTGGATGCAGCGCCGGTATCCGGCGACTGTACCTGGGGGTGGTGCGTAGTATGGCCCTGTACGGTGCTCCCGTGTGGTCGCCCGCACTTACCGCGCGAAACGCGGCTCTGCTGCTCAGAGCTCAGCGGGCGCTCGCGGTGAGGGTCATCAGGGGGTACCGTACCATCTCTCAGGATGTGGTCTGTGCCCTCGCCGGATCCTTACCGTGGGACCTCGAGGCCGAAATCTTGGCCGCGACATACCGACGGAGAAGACAGTCCTCGACTCGGGAACAGACACCCGGCCCGTCGGTTGTCGATCGATGGAGGCATGCTGCGCGTGGTCTGGCGTATGCCAAATGGAGAGAGCGCTTGTTGGAGGAGCTCGGCCGAACTTCGGCCACTCGTCAGCGCACGCTCGAGGCACTGGTGCCTGTGCTGAAGGCATGGTCGGACCGGCGACATGGTGAGCTCTCCTTTCGCCTCACCCAGGTCCTTTCGGGGCATGGATGCTTCGGGAGGTATCTGTGGAGAGTCTGCAGAAGGGAGCCACATCCGGGCTGCCACCAGTGCGGGCACCCGAACGATGACGCTCAGCACGCGCTAGAAGCGTGCCCACGGTGGGAGCACCCGCGGCGAAACCTCGTCGCGGTGTTGGGGCAGGACCTCTCTTTGAGGGCTATCGTCGCCCGTATGGTAGAGGACCGGAGTTCGTGGGAGGCCATGGCTGGGTTCTGTGACTTGGTCATGGCGCTTCGTGAGGCTGAGGAGCGCGAAAGGGAATGGGATCCCTCTTCGGCTCCTCAGCGCAGAAGGCGGGGTGGACGGCGCGTGCGAGAGGCCGCCGCTCAGCCCTCGTAG
Protein
MAKVFRCVVCYADDTLVTARGDDYRSAAILAVAGVATVVSRIKRLGLEVALHKSEAVCFHSAREGPPQGANLVVGGVTIAVQPKLKYLGLVLDSKWRFDHHFKMLVPRLMGTAGALTRLLPNTGGCSAGIRRLYLGVVRSMALYGAPVWSPALTARNAALLLRAQRALAVRVIRGYRTISQDVVCALAGSLPWDLEAEILAATYRRRRQSSTREQTPGPSVVDRWRHAARGLAYAKWRERLLEELGRTSATRQRTLEALVPVLKAWSDRRHGELSFRLTQVLSGHGCFGRYLWRVCRREPHPGCHQCGHPNDDAQHALEACPRWEHPRRNLVAVLGQDLSLRAIVARMVEDRSSWEAMAGFCDLVMALREAEEREREWDPSSAPQRRRRGGRRVREAAAQPS

Summary

EMBL
D85594    BAA19776.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
KZ150386    PZC71062.1    AB078929    BAC06452.1    AB078935    BAC06462.1    RSAL01000481    RVE41577.1    AB090825    BAC57926.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    KZ150308    PZC71477.1    AB126050    BAD86650.1    LBMM01024882    KMQ82501.1    LBMM01014132    KMQ85305.1    LBMM01006954    KMQ90166.1    LBMM01008861    KMQ88580.1    KQ460685    KPJ12887.1    LBMM01009494    KMQ88097.1    LBMM01019839    KMQ83438.1    LBMM01004505    KMQ92346.1    QOIP01000010    RLU18098.1    LBMM01015018    KMQ84954.1    LBMM01019838    KMQ83439.1    LBMM01006725    KMQ90373.1    LBMM01005216    KMQ91703.1    LBMM01015025    KMQ84953.1    LBMM01004272    KMQ92618.1    LBMM01009527    LBMM01009515    KMQ88059.1    KMQ88067.1    LBMM01005733    KMQ91252.1    QOIP01000031    RLU14697.1    LBMM01008349    KMQ88951.1    LBMM01002052    KMQ95336.1    LBMM01003988    KMQ92922.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01014122    KMQ85315.1    LBMM01002480    KMQ94776.1    GGMR01014918    MBY27537.1    LBMM01008422    KMQ88894.1    LBMM01007036    KMQ90099.1    LBMM01004634    KMQ92224.1    LBMM01014956    KMQ84982.1    GGMR01011974    MBY24593.1    GFXV01002242    MBW14047.1    LBMM01007659    KMQ89538.1    GAPW01002043    JAC11555.1    GALA01001066    JAA93786.1    LBMM01005465    KMQ91492.1    GALA01001776    JAA93076.1    LBMM01009738    KMQ87908.1    KMQ94772.1    GALA01000302    JAA94550.1    ABLF02009991    ABLF02009992    ABLF02054952    LBMM01003679    KMQ93242.1    ABLF02014530    ABLF02018586    ABLF02058000    LBMM01006496    KMQ90570.1    GALA01001777    JAA93075.1    GGMR01006838    MBY19457.1    LBMM01006063    KMQ90967.1    KU543679    AMS38363.1    GBHO01002982    JAG40622.1    LBMM01021647    KMQ83033.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGMR01012534    MBY25153.1    GAPW01002123    JAC11475.1    GEHC01000964    JAV46681.1    LBMM01005474    KMQ91485.1    GAPW01002021    JAC11577.1    ABLF02020647    ABLF02020648    ABLF02018942    ABLF02041885    LBMM01008448    KMQ88867.1    ABLF02011238    ABLF02011183    ABLF02041884    AAZX01012143    AAZX01012194    ABLF02017307    GGFL01001583    MBW65761.1    ABLF02034925    GDHF01014602    JAI37712.1    GAPW01000192    JAC13406.1    GGMR01000779    MBY13398.1    LBMM01012595    KMQ86127.1    GEHC01000915    JAV46730.1    GECU01032129    JAS75577.1    GAKP01002292    JAC56660.1    GAPW01001826    JAC11772.1    AB090814    BAC57904.1    GALX01004785    JAB63681.1    LBMM01007638    KMQ89555.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF00098   zf-CCHC
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
402
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.48481
Exp number, first 60 AAs:
0.55931
Total prob of N-in:
0.08562
outside
1  -  402
 
 

Population Genetic Test Statistics

Pi
234.876289
Theta
40.527549
Tajima's D
1.310861
CLR
0
CSRT
0.746812659367032
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号