SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11121
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.517
 

Sequence

CDS
ATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAATCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTCTTTCATAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATTTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACGCACATAGACACCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTCGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGGTAACCGTACTCGTCGAACTCGACAAAGAGTTCGCCGTGCAACCTAA
Protein
MANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGIPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFHRGSSTRISSRIRRRNLTPPITLFSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLGNRTRRTRQRVRRAT

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    AF081101    AAC72919.1    KQ459580    KPI99178.1    GALX01005359    JAB63107.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    GGMR01019198    MBY31817.1    KQ971729    KYB24751.1    GALX01005300    JAB63166.1    ABLF02008933    ABLF02014862    ABLF02014866    ABLF02061908    GGMS01004685    MBY73888.1    KQ973342    KXZ75569.1    ABLF02042518    ABLF02057746    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    KK117880    KFM71667.1    KK113014    KFM59099.1    GEZM01038405    JAV81653.1    GGMR01016114    MBY28733.1    ABLF02066620    ABLF02019349    ABLF02041900    ABLF02033757    GFTR01008038    JAW08388.1    AF012049    AAC24972.1    GBBI01004571    JAC14141.1    GGMR01018716    MBY31335.1    GGMS01000737    MBY69940.1    ABLF02008463    GBBI01004395    JAC14317.1    GGMR01000676    MBY13295.1    NEVH01006721    PNF37225.1    RPOV01000134    RPJ78669.1    NEVH01003017    PNF40781.1    NEVH01010546    PNF32261.1    NEVH01007443    PNF35684.1    NEVH01020071    PNF21969.1    NEVH01006736    PNF36716.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    NEVH01005938    PNF38077.1    NEVH01026386    PNF14434.1    GEZM01053022    JAV74219.1    NEVH01001355    PNF42855.1    NEVH01002704    PNF41489.1    GGMR01003407    MBY16026.1    NEVH01012084    PNF30905.1    NEVH01021205    PNF19912.1    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01023961    PNF17613.1    NEVH01000269    PNF43694.1    GGMS01012005    MBY81208.1    NWSH01000032    PCG80497.1    NEVH01000280    PNF43672.1    GGMS01008766    MBY77969.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01014858    PNF27387.1    NEVH01019964    PNF22161.1    NEVH01006754    PNF36554.1    NEVH01007838    PNF34986.1    NEVH01020940    PNF20481.1    NEVH01017559    PNF23833.1    NEVH01002716    PNF41415.1    NEVH01000598    PNF43535.1    NEVH01011985    PNF31054.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01017542    PNF24034.1    KL813758    KFM83187.1    NEVH01017470    PNF24199.1    GGFJ01001857    MBW50998.1    NEVH01019376    PNF22596.1    GFXV01006424    MBW18229.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    GGMR01004661    MBY17280.1    S59870    AAB26437.2    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01016302    PNF25823.1    GBGD01000880    JAC88009.1    LBMM01014395    KMQ85192.1    GGMS01017914    MBY87117.1    ABLF02034467    NEVH01026154    PNF14491.1    JRES01000644    KNC29657.1    GGFJ01001858    MBW50999.1    GBGD01000799    JAC88090.1    ABLF02021177    ABLF02027367    ABLF02066338    LBMM01013518    KMQ85605.1    PCG80496.1    GGMS01006359    MBY75562.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    DNOY01000259    HBE18313.1    GDHC01014349    JAQ04280.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
466
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.511130000000001
Exp number, first 60 AAs:
0.00381
Total prob of N-in:
0.02194
outside
1  -  466
 
 

Population Genetic Test Statistics

Pi
80.213087
Theta
43.930567
Tajima's D
2.663177
CLR
0.327406
CSRT
0.95865206739663
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号