SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11120
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Guanylate cyclase      
Location in the cell
Mitochondrial   Reliability : 2.264 Nuclear   Reliability : 1.593
 

Sequence

CDS
ATGTGGACCTGGATCTCGCCGGATGGTAAAACAAAAAATGAAATTGATTTTATTATGACCAACAGAAACAGCTACTTCACAAACTTTACCGTCATTAAAAGATTTAACTTCAACACCAACCATAGGCTACTTAGAACTGAGCTCAAAATAAAACAACCAAAGAAGACTAGACCAAGACAAGACTCAGGAAACATAAAACTCGAAGAACAACACTTAGAGCAAATAACAACAGCTCTAAGAGCTGAACTTAGAAACTTCAAAGAGAACACTAAGGAACTAGAAACCCAAGATAAATACAAGTATATAGAGAATATTATTAAAACCCAAACTAAACTTATAACAGATAGGAAAATTAATGCAAAAGAAAAACTATCAACAGCCACTATAAAACTCCTAGAAGAAAGAAATTACCTTACTAATGAAAGAAGTACCCAAAACAGAAGACAGAAATTAGCCAAAATCAGCAAAGATATCAAGGAAAGTATCAGAAAAGAAAGAAAACAACGAAGGTTGCAAACAATCGAAAATTACATACGAAAAACCGGTGGAACTAAAAAAGCACTCAAAGAATTGACCGACACGAAGAACTGGATCGTAAAAATGAAAGATAACCGAGGAAAATTCGATTATCACAGAATTGGCATATTAAAAACAGCTACGTCATATTACAAAAATCTTTATCGAAACAACACTACGCAAGCTGAAATCAGTCTAGTGGAAACCTCGAACACCCCCAGTATTCTCCAAGCTGAAGTCAGTAAGGCTATCGATACCCAAAAGAGTGAGAAAGCACCCGGGCCTGACGGCATAAGCAATGAAATCTTAAGAAATAGCAAAGAGATACTGCTACCTGTCCTCACAGAAATATTCAATGATATAATGAATACTGAAACCATCCCCCAGCAATGGACCGAGTCTCTCATCATCCTACTGTATAAGAAAGGTGATAAATATGACATAGGAAATTATCGCCCTATAAGTCTTATGTCCAATGTATATAAGATTTTTGCTAAGATCATCTTAAAACGGATTGAAAGAACCCTAGACGAAAACCAACCTATAGAGCAAGCAGGATTCCGCAAAGGTTACTCAGTGATTGACCACATTCACGTAGTGCGTCAAATTTTGGAGAAATACAACGAGTACCAACTTACATACTACATCGCATTCATTGATTATAGTAAAGCATTCGATTCTCTACATCATGACAAAATATGGGGGGCGTTATTAGAACAAGGAATTGAGCACAAGTACATTCGATTAATAAGAAATATATATAGCTGCAGCAGAGCAAGAATCCAACTAGAAAAGAAAAGTACTCCTTTCAGAGTAGAAAAAGGCGTAAGGCAGGGAGACCCTCTATCTCCGAAATTATTCTCCGCAGTATTAGAATCAATCTTTCGAAGACTCAATTGGGAACATCTTGGAATTAATATAGACGGCCAACTGGTATCACACTTAAGATTTGCTGATGACATAGTGTTAATGGCCAAAACAGCAGAAGAGTTAACCAGAATGATAAAAGAACTTGCGAAAGAAAGTGAGAGAGTAGGGCTGGCAATGAATCCGGAAAAAACTAGGGTGATGACAAACGGGTACAAACATACAATAGATCTAGGAAACACTGAAATCAACTATACAGACGAGTACGTATATCTAGGGCAGCTCATAACTCAAAAAGATCCTATGCAGAAGGAAGTGGACAGAAGAATTACAAATGGCTGGAAGACATACTGGAGTCTAAGAGAGGCTATGAAAGATAAAAAGCTCCATATAAACCTAAAAAGCAAACTTTTTAACACCTGCGTACTACCTGTCCTTACATACGGGTGTCAGTCATGGTCCTTAAATCAGGTCACCTCAAACAAACTAGCAACCTGCCAGTATGCAATGGAAAGGAGTATGCTAAACATTAAAAAGTCCGACAGAGTAAAAAAAATCGTCATTAGAATCAAAACAAAAACTACCGATATAATAAGCAAAATCAAAAGACTCAAATGGCGATGGGCTGGTCACCTGGTAAGAGGACACGACAAATGGAGCAAAAGGGTGACATGGTGGTACCCAAGGGAAGGCAAAAGAAAAAGAGGTCGACCACAGAAAAGGTGGGACGATGACGTTAGACAAGTGGCAGGAGTCACATGGAACAGAGTGGCTCAAGAAAGAAAGGAATGGAAAAGGTTGGAGGAGGCCTTTGCCGACTGGCAAACAGATCTAGGAAAGATAACCAAACAACAAATATTAGTTTAA
Protein
MWTWISPDGKTKNEIDFIMTNRNSYFTNFTVIKRFNFNTNHRLLRTELKIKQPKKTRPRQDSGNIKLEEQHLEQITTALRAELRNFKENTKELETQDKYKYIENIIKTQTKLITDRKINAKEKLSTATIKLLEERNYLTNERSTQNRRQKLAKISKDIKESIRKERKQRRLQTIENYIRKTGGTKKALKELTDTKNWIVKMKDNRGKFDYHRIGILKTATSYYKNLYRNNTTQAEISLVETSNTPSILQAEVSKAIDTQKSEKAPGPDGISNEILRNSKEILLPVLTEIFNDIMNTETIPQQWTESLIILLYKKGDKYDIGNYRPISLMSNVYKIFAKIILKRIERTLDENQPIEQAGFRKGYSVIDHIHVVRQILEKYNEYQLTYYIAFIDYSKAFDSLHHDKIWGALLEQGIEHKYIRLIRNIYSCSRARIQLEKKSTPFRVEKGVRQGDPLSPKLFSAVLESIFRRLNWEHLGINIDGQLVSHLRFADDIVLMAKTAEELTRMIKELAKESERVGLAMNPEKTRVMTNGYKHTIDLGNTEINYTDEYVYLGQLITQKDPMQKEVDRRITNGWKTYWSLREAMKDKKLHINLKSKLFNTCVLPVLTYGCQSWSLNQVTSNKLATCQYAMERSMLNIKKSDRVKKIVIRIKTKTTDIISKIKRLKWRWAGHLVRGHDKWSKRVTWWYPREGKRKRGRPQKRWDDDVRQVAGVTWNRVAQERKEWKRLEEAFADWQTDLGKITKQQILV

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
EC Number
4.6.1.2
EMBL
FJ265564    ADI61832.1    FJ265561    ADI61829.1    KZ150485    PZC70710.1    + More
KZ150108    PZC73382.1    FJ265562    ADI61830.1    FJ265563    ADI61831.1    GBBI01004876    JAC13836.1    ODYU01008249    SOQ51673.1    KZ149907    PZC78256.1    FJ265549    ADI61817.1    ODYU01004088    SOQ43598.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    GBGD01000380    JAC88509.1    KZ150317    PZC71439.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    JARK01001655    EYB84321.1    FJ265551    ADI61819.1    FJ265545    ADI61813.1    UZAG01000503    VDO08661.1    MRZV01000899    PIK42833.1    JARK01000347    EYC38051.1    JARK01001639    EYB85201.1    JARK01001621    EYB86109.1    JARK01000460    EYC36749.1    JARK01001389    EYC11015.1    JARK01001340    EYC30828.1    JARK01001626    EYB85833.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001568    EYB89432.1    JARK01001362    EYC18844.1    EYC18843.1    JARK01001370    EYC16376.1    JARK01001353    EYC22263.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001630    EYB85641.1    JARK01001348    EYC25048.1    JARK01001473    EYB97806.1    EYC25050.1    JARK01001475    EYB97550.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    EYB98081.1    EYC40601.1    JARK01001344    EYC28216.1    JARK01001502    EYB94855.1    EYC33297.1    JARK01000161    EYC41641.1    EYC25049.1    JARK01001401    EYC08686.1    JARK01000248    EYC39628.1    JARK01000063    EYC44387.1    JARK01001346    EYC26445.1    EYC10874.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001372    EYC15614.1    JARK01001421    EYC04912.1    JARK01001581    EYB88505.1    JARK01001497    EYB95322.1    EYC03125.1    JARK01000165    EYC41537.1    EYC30744.1    JARK01001365    EYC18010.1    JARK01000008    EYC46079.1    EYC25046.1    EYB95049.1    EYC18009.1    JARK01001612    EYB86585.1    JARK01000109    EYC42952.1    JARK01000302    EYC38674.1    JARK01001407    EYC07212.1    JARK01001582    EYB88498.1    JARK01001618    EYB86258.1    JARK01001357    EYC20551.1    JARK01001531    EYB92324.1    JARK01001637    EYB85284.1    JARK01001565    EYB89683.1    JARK01001337    EYC34625.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01000177    EYC41210.1    EYC41209.1    EYB85282.1    JARK01000132    EYC42415.1    JARK01001424    EYC04316.1    EYC04315.1    EYC04317.1    EYC04314.1    EYC25145.1    JARK01000256    EYC39462.1    EYB85285.1    JARK01000249    EYC39611.1    JARK01001543    EYB91353.1    JARK01001388    EYC11165.1    JARK01000146    EYC42042.1    JARK01001438    EYC02111.1    JARK01000173    EYC41342.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF00211   Guanylate_cyc
PF07714   Pkinase_Tyr
PF01094   ANF_receptor
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR029052   Metallo-depent_PP-like       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR001170   ANPR/GUC       
IPR011009   Kinase-like_dom_sf       
IPR028082   Peripla_BP_I       
IPR001054   A/G_cyclase       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
SUPFAM
SSF56219   SSF56219        + More
SSF56112   SSF56112       
SSF53822   SSF53822       
SSF55073   SSF55073       
Gene 3D
PDB
6AR3     E-value=0.000204105,     Score=109

Ontologies

Topology

Length:
749
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00339
Exp number, first 60 AAs:
0.00117
Total prob of N-in:
0.00019
outside
1  -  749
 
 

Population Genetic Test Statistics

Pi
18.086651
Theta
20.518826
Tajima's D
0
CLR
0.006931
CSRT
0.369081545922704
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号