SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11090
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Extracellular   Reliability : 1.201 Mitochondrial   Reliability : 1.627
 

Sequence

CDS
ATGGCAGGTGCATTAGTCCGTCTTCTGCCCAACGTTGGTGGTTGCGGCGTCGGTGTCCGACGCCTGTACCTGGGGGTCGTGCGCAGTATGGCCTTGTATGGCGCTCCCGTGTGGTCGCCCACACTCTCCGCACGCAATGCGGCACTGCTGCTCCGAGCTCAGCGGGCGCTCGCGGTGAGGGTCATCAGGGGGTACCGTACGATCTCCCGAGAGGTCGCCTGCGCCCTCGCTGGTTCCCTTCCTTGGGATCTCGAGGCCGAGGTATTGGCTACGGTATACCGGCGCAGGACACAGTCCCTGAGTCGGGGACGGACACCCGGCCTGTCGGCTGTCAGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCTAAATGGAGGGAGCGGTTGCTGGAGGAACTTCATCAAACCTCAGCCACCCGCCGGCGCACTCTCGAGGCCCTGGTGCCCGTGCTGGAGACATGGTCAGATCGGCGACACGGCGTGCTCTCCTTCCGCCTTACGCAGGTTCTCTCGGGGCATGGCTGCTTCGGGAGGTACCTGTGGAGGGTTTGCAGGAGAGAGCCACATCCGGGTTGTCACCAGTGCGGGCATCCGGATGATGACGCTCAGCACGCACTCGAAGCGTGCCCGCGTTGGGAGCACCCGCGGCGAGATCTCATCGCGGTGCTGGGGAGGGACCTCTCCTTGCGGGCTGTCATTGCCCGCATGCTAGAGGATGAGAGTTCGTGGGAGGCCATGGCCAGATTTTGCGACCTGGTCATGGCGTTCCGCGAGGCTGAAGAGCGCGAAAGGGAGTGGAATCCCTCTTCGGCTCCTCAGCGAAGAAGGCGGGGTGGGCGACGCGGGCACGATGCTCCCGTTAATCTCCCGTAG
Protein
MAGALVRLLPNVGGCGVGVRRLYLGVVRSMALYGAPVWSPTLSARNAALLLRAQRALAVRVIRGYRTISREVACALAGSLPWDLEAEVLATVYRRRTQSLSRGRTPGLSAVSRWRRAARHLAYAKWRERLLEELHQTSATRRRTLEALVPVLETWSDRRHGVLSFRLTQVLSGHGCFGRYLWRVCRREPHPGCHQCGHPDDDAQHALEACPRWEHPRRDLIAVLGRDLSLRAVIARMLEDESSWEAMARFCDLVMAFREAEEREREWNPSSAPQRRRRGGRRGHDAPVNLP

Summary

EMBL
D85594    BAA19776.1    KZ150308    PZC71477.1    RSAL01000481    RVE41577.1    + More
AB126050    BAD86650.1    AB078935    BAC06462.1    KZ150386    PZC71062.1    AB078930    BAC06454.1    AB078931    BAC06456.1    LBMM01009501    KMQ88083.1    KZ149950    PZC76665.1    KZ149896    PZC78733.1    AB078929    BAC06452.1    AB090825    BAC57926.1    LBMM01012027    KMQ86470.1    ODYU01009945    SOQ54696.1    RSAL01000109    RVE47213.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01008861    KMQ88580.1    LBMM01009494    KMQ88097.1    LBMM01003679    KMQ93242.1    LBMM01014132    KMQ85305.1    QOIP01000010    RLU18098.1    QOIP01000031    RLU14697.1    KQ460685    KPJ12887.1    LBMM01005733    KMQ91252.1    LBMM01006909    KMQ90209.1    LBMM01006954    KMQ90166.1    LBMM01006110    KMQ90925.1    GGMR01015518    MBY28137.1    GAPW01002043    JAC11555.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GFXV01002242    MBW14047.1    LBMM01015018    KMQ84954.1    ABLF02023401    ABLF02029423    ABLF02060278    KQ971310    KYB29500.1    KYB29499.1    GFXV01003903    MBW15708.1    GALA01001066    JAA93786.1    LBMM01004505    KMQ92346.1    LBMM01008349    KMQ88951.1    ABLF02011238    LBMM01008682    KMQ88705.1    GGMR01014918    MBY27537.1    ABLF02014530    ABLF02018586    ABLF02058000    GAPW01002021    JAC11577.1    ABLF02041886    GGMR01012534    MBY25153.1    GAPW01002123    JAC11475.1    ABLF02009991    ABLF02009992    ABLF02054952    ABLF02016435    ABLF02016436    ABLF02064751    LBMM01007638    KMQ89555.1    LBMM01006725    KMQ90373.1    GBHO01002982    JAG40622.1    LBMM01005216    KMQ91703.1    GDHF01014602    JAI37712.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GALX01004785    JAB63681.1    GGMR01004600    MBY17219.1    GGMR01011682    MBY24301.1    GALA01001777    JAA93075.1    AB593322    BAK38641.1    AB593326    BAK38647.1    GGMS01001211    MBY70414.1    CH963857    KRF98317.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF00098   zf-CCHC
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
291
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.20918
Exp number, first 60 AAs:
0.20629
Total prob of N-in:
0.01254
outside
1  -  291
 
 

Population Genetic Test Statistics

Pi
5.128225
Theta
5.073083
Tajima's D
-0.748591
CLR
1479.849288
CSRT
0.188990550472476
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号