SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11088
Pre Gene Modal
BGIBMGA011048
Annotation
reverse_transcriptase_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.783
 

Sequence

CDS
ATGGTAAATACCCGCAGTACCGCCAACAAACAAAGAAAAAACGACGATGAGCATGACGCAAAAAGTTCTTGTGCCGCGAGTGCAGTGAAGTCGGAACGAACCGAAAAACAAAATCCGCCTTCACTAGCATCACGTCAGTCAGTCAGGTCCAAGAAAATGTCATCATCAAAATCAATACAAATCCAGAAAAAGAAACTGGAACTAGAAGCAGCTCAGGCGAAGGCGCGTATTCAAATGGAACTCATTGATCAAAAGTTAGCGGCGGATCTAGCAGAACTCGAAGAAGAATACAGTCCACCATCAGAAATATCGGAGAAAAACAACGGCGGTGATATAGAAAAATGGTTAGAGCGTAGTCAACAGGAACTGCAGCAGGCCACTAAGCTCAACAGTGATAAACACAAGTCACACTCAAGCCCGGCCGACAACGACGCAGTTCAACAACTCACGAGCGCATTCAAAGAATTTATGACGTCCTCCGCCATCCAGCAAAATACTAAGCTGCTTAGTCGTCTCAGCACTCCAAAAGAACTCCCTATCTTCAGCGGAGACCCAAAAGAATGGCTTTATTTCGAGCAGGCCTACCTGGAATCGACTGAAGTCTGCAACTTCAGCGATAAAGAAAACCATTGGCGGTTACGAAAGTGTTTACGAGGTACCGCACAAGAAGCCGTCGCCGGCCTACTTATCAGTGGTGCTTCTCCTGCAGAAATAATTTCCACTTTAAAACTACAGTTCGGAAACGCTGACGTCATTCTATCTCGCATCGTGGTAGACGTAAAGAAGATGAATCCACTGCCTACGGACTACCACAAAGAAATAGTACCCTTTTCAGGAAAAGTGAAAAATTACGTGGCCGCTGTACGAGCCCTTGGTCGCCAAGAGTACCTGCAAGGCATGGAAGTGGCTAACATTATCTTATGCAAGCTACCCACGACCCTGCTCACCAAGTGGACAGATTATAGTTATCCGCTTATCACAGCTGAATCGCCGAAACCTAGACTAGAGGTGCTGTCAGATTTCCTCACCGAAGAAGCTGTAAAAGTATCAACCTGTAGTGCTACTTTATTGCAATCTAGGACGGACAATTTCAAACGTAAACTTTATGATAAAGTGAACAATATACAAACAATTTTAGTGCAAGACGGACAAAGTGTACAAAAATGTGGTTATTGTCGTACCGGTAGCCATAAATTAACCGAGTGTAAAAAATTTAAAAAATCACTAAGAAAGGACAGATGGTTCCATGTGAAGCGTTACGGCATTTGTTATAAGTGTTTATTAGCGCATCATCGCAGAGAAACGTGCTCCGCTCCAAGCTGTGACGTAAGCAATTGTGGACAATCGCATCACCGCTTACTGCATTATGTGCCGAGTCGAAACGACACTCAATCTGTATCAGCAGTACAATCTGAAACGCCACCTGAAACTGAAGTTCAGTCTGAAATAGTAACAAATATTAATGTCGGCTGTTCCGTAATGTTAAAAATTGTGCCTATAAATATTCACGGACCGAACGGAATTGTTAGCACGACCGCCTTGCTCGACGATGGCTCGACTGTGTCGTTGATTAGCGCTCCGCTGGCATTACAAGTGGGACTGCGCGGCCGCCACGAACGTCTTCGTGTGCGCGGCGCGTGGAACGACACTGAATTAGTGTGCGATGCGCAGCTAGCAAACGTGACACTATGTAGTAAGTGTAGTACCGATAACAAGATGTTTACAATCGATGCGCGGATTGTCGAAGAGTTAAACCTACCACAAAGTTTGCCTACAGTAAATGTTAAAAAATATTTGCACCTAAATGACATCAGCCATAACTTATGCACCACAACACAACTGCATCCGCAAGTTTTAATTGGACAAGATAATTGTCACCTCCTCTTACCTCTGGAAATGAGAGTGGGTAAGCCCGATGAACCCTGTGCCACCCGGACTCCTCTGGGTTGGTGCCTCCATGGAAGAGTACCTAATGCTTACCTACCTAATTCTGCTGCACGTCACGCTTCATTGTTTGTCTCCAGTGACGTCATAGAATCTGAATGTACTTTGCGAGAGATCCACGAGGAGGTGCGAAGATCGTTCTCAATCGAGTCCATGGGCGTGTCTGGCAAACCAAGACAGAACTCAGAAGATTTACGCGCTGTTGAAATTTTAGAACGAACCTCCACTCTCGTCAATGGTCAATGGCATGTTGGCTTACCTTGGCGGGATGAGACTTGTACGATGCCGGACTCGTACCTAACAGCTCTCCGTAGACTAAAAGGAATCGAACAAAAATTAAAAAATAATAAAGAATATGCAAAAAGATACGAAGAACGAATACGACATTCATTTGAAAATGATTTCGCAAAAAAACTGATCAGCTCAAATGTTACACCACTGAAAACTTGGTATTTACCTCATTTTGGTGTCGATAACCCGAACAAAAAGAAACTGCGCTTAGTGTTTGACGCCGCGGCCAAAACAAATGGTTTGTCCCTGAATGATTACTTATTGAAAGGGCCCGACCTACTAATGTCATTATTCGCCATCATGTTGCGATTTAGAGAAAATCGAATAGCCGTTTCTGGAGATATTAAAGATATGTTTCTCAAAGTGAAAATTCGACCAAAAAACCAGGATGCCTTCCGTTTTTTATATAGAGAAGAACCGGAGGGAAATATAAACACTTACGTTATGACGTCATTAATTTTTGGTGCTAATTGTTCGCCATTTATAGCTCAATTTGTAAAAAATAAAAACGCTCAGCGGTATGAGTCATCAATGCCCGCTGCTGCTTCCGCCATATATAGGAGTCACTATATGGACTATATCCACTATATGGATGATTACATAACCGAAGCGGTATTCCAGAAATGGTTGAAATGGATTTATCTTCTGGAATCATTAAAAGACGTGAGTTTGCCGAGGTACTATCCGGCTGCTACCATACGAGAGAATGAGACGAATAATGAAACCCTTCCGCTGTCATCCTCACACAACGCGATTTCTAGGACTACGGCTACGAATAATGCTACGAGCGTAGCACACGCCGAATCCGCTACGAATACTGCATCGCACAGCTACAATAATAATTGTGGAGACGATTACAGTGGAGTTTTAACTCGAACTGGATATAGAAACTTACAGATGCATATATTTTGTGATGCGTCTAACAAAGCATACTGCGCCGTCGCGTACTGGAGATGGATTGACGACGAGTTTAACATACCCGTAGCATTCATTGCGAGCAAATCTCGAGTTGCAGGAAACAAACCTATTACCATCCCACGTTTGGAACTTCAAGCCGCCGTCTTAGCGGCAAGACTAGCGGACTCAGTCACTAGAGAACATATTATAAAGCCTGAGCAACGAATATTTTGGAGCGACTCGACGACAGTGCTGCAATGGATAAGAAATGACGCTCGCGACTATAAAGTTTATGTGGCAAATCGTTTGGGCGAAATTGATGAGTTAACAAAGATAAAAGAATGGCGTTATGTTCCCACTAAATTAAACGTCGCTGATATTGCAACGAGAGAAAACTATAAATTCCCGGCCCTCCAAGATGAATGGTTGTATGGACCTACCTTCTTACGCCACGAAGCAAACGAATGGCCTCACGACTTCATAAGCGACAGAAAAGAAACACTGCCAGAATGTGTTAATTTGATAAAAGTAGAAGTACAGGAAATTAACTTACCTGTACCTGATGCTACAAGATTTAGTTCTTGGCTTCGCTTGCTTCGATCCACTTCATTAGTACTCAAATTTATAAACAAATGCAAAAAACTTACCTTTGAGTTCGACGATGCTATGGAGAAAGCTGAAATATTGTTACTGAAAAAATCACAAGCTGAATCGTATAAAAAAGAGTTAACTGAAATAAAAAACAGTGGATGTGTATCAAAAACAAGTAATATACTTACCTTGTCCCCTTACTTAGACGAGTATGGAGTTAAGAGTCGGTGGCCGCATCGGTGCTGCTACTGGCATTCTACCTTAATCAAAAACCCTATTATACTAGACGGAACAAGCTACATTGCTAGATTGATCGTGAAATATTATCATTATTACTACGCACACGGAAATCAAGAAACAATAGTAAATGAAGTCAAACAAAGATACTGGATCACAAGACTGAGACCTACCGTTAAACATATAACATCTAAATGCTCATTTTGTAGAATAAGAAAATCCAAACCAGAAGTATAA
Protein
MVNTRSTANKQRKNDDEHDAKSSCAASAVKSERTEKQNPPSLASRQSVRSKKMSSSKSIQIQKKKLELEAAQAKARIQMELIDQKLAADLAELEEEYSPPSEISEKNNGGDIEKWLERSQQELQQATKLNSDKHKSHSSPADNDAVQQLTSAFKEFMTSSAIQQNTKLLSRLSTPKELPIFSGDPKEWLYFEQAYLESTEVCNFSDKENHWRLRKCLRGTAQEAVAGLLISGASPAEIISTLKLQFGNADVILSRIVVDVKKMNPLPTDYHKEIVPFSGKVKNYVAAVRALGRQEYLQGMEVANIILCKLPTTLLTKWTDYSYPLITAESPKPRLEVLSDFLTEEAVKVSTCSATLLQSRTDNFKRKLYDKVNNIQTILVQDGQSVQKCGYCRTGSHKLTECKKFKKSLRKDRWFHVKRYGICYKCLLAHHRRETCSAPSCDVSNCGQSHHRLLHYVPSRNDTQSVSAVQSETPPETEVQSEIVTNINVGCSVMLKIVPINIHGPNGIVSTTALLDDGSTVSLISAPLALQVGLRGRHERLRVRGAWNDTELVCDAQLANVTLCSKCSTDNKMFTIDARIVEELNLPQSLPTVNVKKYLHLNDISHNLCTTTQLHPQVLIGQDNCHLLLPLEMRVGKPDEPCATRTPLGWCLHGRVPNAYLPNSAARHASLFVSSDVIESECTLREIHEEVRRSFSIESMGVSGKPRQNSEDLRAVEILERTSTLVNGQWHVGLPWRDETCTMPDSYLTALRRLKGIEQKLKNNKEYAKRYEERIRHSFENDFAKKLISSNVTPLKTWYLPHFGVDNPNKKKLRLVFDAAAKTNGLSLNDYLLKGPDLLMSLFAIMLRFRENRIAVSGDIKDMFLKVKIRPKNQDAFRFLYREEPEGNINTYVMTSLIFGANCSPFIAQFVKNKNAQRYESSMPAAASAIYRSHYMDYIHYMDDYITEAVFQKWLKWIYLLESLKDVSLPRYYPAATIRENETNNETLPLSSSHNAISRTTATNNATSVAHAESATNTASHSYNNNCGDDYSGVLTRTGYRNLQMHIFCDASNKAYCAVAYWRWIDDEFNIPVAFIASKSRVAGNKPITIPRLELQAAVLAARLADSVTREHIIKPEQRIFWSDSTTVLQWIRNDARDYKVYVANRLGEIDELTKIKEWRYVPTKLNVADIATRENYKFPALQDEWLYGPTFLRHEANEWPHDFISDRKETLPECVNLIKVEVQEINLPVPDATRFSSWLRLLRSTSLVLKFINKCKKLTFEFDDAMEKAEILLLKKSQAESYKKELTEIKNSGCVSKTSNILTLSPYLDEYGVKSRWPHRCCYWHSTLIKNPIILDGTSYIARLIVKYYHYYYAHGNQETIVNEVKQRYWITRLRPTVKHITSKCSFCRIRKSKPEV

Summary

Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
Interpro
IPR012337   RNaseH-like_sf        + More
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
1398
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10831
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00402
outside
1  -  1398
 
 

Population Genetic Test Statistics

Pi
217.132001
Theta
178.897903
Tajima's D
0.226054
CLR
1.371228
CSRT
0.430378481075946
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号