SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11065
Annotation
PREDICTED:_uncharacterized_protein_LOC103311346_[Acyrthosiphon_pisum]
Location in the cell
Extracellular   Reliability : 1.007
 

Sequence

CDS
ATGGTCACAGTTGACGTACGCCCGGACGAGATCACACGTAATCCTACCTTCGAGTCTAGCACTGCAGCCTCCACTAATGCGTATGTGGGCTACAGTCGCTCGGTAGTTCTGTTGGGTACTTGTGTAGTTCGCGTTCGTCATCCTCGCAGTACTAATCAATCATTTCTTGTACGTGCGTTGATTGATAGTGGTGCTCAAGATTGTTTCATTACCAAGTCATGTTGTCAACGTTTGGGCTTACCATTACGTCGCTGTCCATTAGCCGTAGTTGGTCTAGGTCAAAATGCTGTACATCACGTGACTGGAGTTACTTCTTGCACTGTACTTTCTCGTACTTCAGAAAATCCTCATTTCAACATTAATCCTATCGTAGTAAATACTATAACGAGTAAAATGCCTGCTACAAACTTACCTACTAATCTTCGTGAATCTTTTAAACATCTGGTCCTCGCTGATGAGAATTTTGATAAACCATCAAATGTAGATTTACTACTCGGCGCAGAACTGTTCCATAGTATTTATGACGGTCAACGCGTTCAGCCCAGTCATGATCTACCGGTAGCTTTACACAGCGTATTTGGTTGGGTCATCACCGGCAAACTTGATACAAACCATTTACCTCCGCCAACAATATCTTCTCTCTTAGCATCCACACGTTCTCTAGACGAGGGACTCAAGCGATTCTGGGAGATCGAAGAACCTCCAAGTCAGGTTATCTTAAACCCTGAAGATATTAAATGTGAACAAATGTACTCAAATCTAACGTATCGTAATCCCGACGGCAGATATGTTGTACCTATGCTTCTCAAAGAACCTATCAGTCAACTAGGCGATTCTTTCAACCAATCTTTCTCTCGGCTCGTTAACCTAGAACGACGCCTTAATCGAAACTTAGAGTTGAAAAAAGAGTACACCGCCTTTATGCGCGAATACAAGCTGTTAGGGCATATGGAGCCTAGCGCTGACTCGAATAAAATCGGGCAGTATATAATTCCTCATCATTGTGTCATTCGCCCGGAAAGTACAACGACTAAACTTAGGGTTGTATTCGATGCTAGCGCCAAAACTACCAATGGCAAATCTCTTAACGATCTTGTATATACTGGTCCAAAACTTCAAAACGATATAGGAGATATACTTACAAAATTTCGGTTGCATGCTGTTGTTTTTACTGCCGACATCAGTAAGATGTATCGAAACATCGTACTTAGGCCAGAAGACCGAAAATGGCAGCATATACTTTGGCGCGATTCTCCTTCTGATCCTGTAACTGAGTATGAGCTGAAAACGGTAACTTACGGGGTTACGAGTTCCCCTTATCTGGCAATACGTACTCTGCATCAATTAGCCTCTGACTACGAAAAAGAGTGGCCCTTAGCTGCTGCTAGTCTTCGTCATGATACTTTCATGGATGACATCACTGTTGGTGCTACATCTATTGAAACTGCACTGAAACATAAAGAAGAGTTAATACAAATGTTAGCGCGTGCTAAGTTCGAATTACGTAAATGGAGTAGCAACTCACCTGAATTCCTCACCCAGATACCAACGGAACATTGTCAGGTTCCAAAAACATTTTGTGATGAAAAACAAAAACAAAGTATCAAGATTCTTGGAGTCCGATGGGATCCAGCTGATGATAACTTCACTTATGCTTTATCAGAACTCACTCCAGGGAATACAAAACGTTCTATTCTATCAAACGTCGCCAGAATTTATGATCCACTCGGATGGTTAGCCCCAATGGTTCTAATAGCTAAGCTTACCTTACAAGAACTATGGCGCCTTCAGCTTGACTGGGATGAAACTGTACCGTCAGATATGTTGTCTCAGTGGCATCTATTTACATCCGAGTTTCACTACCTGAAGGATATTAAAATTCCTCGACTAATTGTACCTCTTCATTCAAAATCATACGAACTTGTAGGTTTTTGTGATGGATCTACCAAGGCTTATGGTTGTTCTGTGTACTTACGTATCACTACCGACACTGAAATTACATCTCACTTGCTTATTGCAAAATCTAAAGTAGCTCCATTAAAAGTTCTTACTGTCAACCGATTGGAGCTATGTAGTGCTGTATTGCTAGCAAAAGTATTGAAGCATATTAGTAATTTACTAAATGAAACTCAAACCTCAAACATAACAATTTCAAAGATATGGGCATTCACTGATAGCTCAACTGTACTATCATGGCTGCAAACAGCACCTCATCGTCTTAAAACTTTCGTTGCACACCGTGTCGTGAAGCTGTTAGATAATTTGTCTGTCGAAAATTGGTATCACGTGTCAACGTATGATAATCCAGCAGATTACTGCAGTCGTGGTCTTACCTGCTCTCAACTTGTGGCTTGTTCCACTTGGTGGACAGGACCCAAATGGATAGTCTCGAATTCTTCTACATGGCCGGTGTCTGAAAAATTACCTTATTTAAAGGAATTAGCCGAAAACTAG
Protein
MVTVDVRPDEITRNPTFESSTAASTNAYVGYSRSVVLLGTCVVRVRHPRSTNQSFLVRALIDSGAQDCFITKSCCQRLGLPLRRCPLAVVGLGQNAVHHVTGVTSCTVLSRTSENPHFNINPIVVNTITSKMPATNLPTNLRESFKHLVLADENFDKPSNVDLLLGAELFHSIYDGQRVQPSHDLPVALHSVFGWVITGKLDTNHLPPPTISSLLASTRSLDEGLKRFWEIEEPPSQVILNPEDIKCEQMYSNLTYRNPDGRYVVPMLLKEPISQLGDSFNQSFSRLVNLERRLNRNLELKKEYTAFMREYKLLGHMEPSADSNKIGQYIIPHHCVIRPESTTTKLRVVFDASAKTTNGKSLNDLVYTGPKLQNDIGDILTKFRLHAVVFTADISKMYRNIVLRPEDRKWQHILWRDSPSDPVTEYELKTVTYGVTSSPYLAIRTLHQLASDYEKEWPLAAASLRHDTFMDDITVGATSIETALKHKEELIQMLARAKFELRKWSSNSPEFLTQIPTEHCQVPKTFCDEKQKQSIKILGVRWDPADDNFTYALSELTPGNTKRSILSNVARIYDPLGWLAPMVLIAKLTLQELWRLQLDWDETVPSDMLSQWHLFTSEFHYLKDIKIPRLIVPLHSKSYELVGFCDGSTKAYGCSVYLRITTDTEITSHLLIAKSKVAPLKVLTVNRLELCSAVLLAKVLKHISNLLNETQTSNITISKIWAFTDSSTVLSWLQTAPHRLKTFVAHRVVKLLDNLSVENWYHVSTYDNPADYCSRGLTCSQLVACSTWWTGPKWIVSNSSTWPVSEKLPYLKELAEN

Summary

Similarity
Belongs to the synaptobrevin family.
EMBL
GALX01004947    JAB63519.1    GBHO01006408    JAG37196.1    ABLF02026240    ABLF02055027    + More
GBRD01007977    JAG57844.1    GFTR01008866    JAW07560.1    GGMR01018294    MBY30913.1    GGMR01017890    MBY30509.1    GBHO01044316    JAF99287.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GECZ01008071    JAS61698.1    GBHO01038800    JAG04804.1    RSAL01000392    RVE41994.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    ABLF02066034    LBMM01012238    KMQ86334.1    GBHO01039691    GBHO01039690    JAG03913.1    JAG03914.1    ABLF02008594    ABLF02041762    ABLF02030854    ABLF02067347    ABLF02025193    GEBQ01028569    JAT11408.1    GEBQ01015458    JAT24519.1    GBHO01000059    JAG43545.1    GEBQ01000825    JAT39152.1    GGMR01006575    MBY19194.1    GEBQ01015737    JAT24240.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GDHC01018192    JAQ00437.1    GBHO01000060    JAG43544.1    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    ABLF02005684    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GBHO01000061    JAG43543.1    GEZM01054766    GEZM01054765    JAV73410.1    GGMR01016460    MBY29079.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    ABLF02003339    ABLF02058001    GBHO01007689    JAG35915.1    GEZM01085145    GEZM01085143    JAV60187.1    GDHC01016272    JAQ02357.1    GGMR01003897    MBY16516.1    JAV73413.1    GAMC01006864    JAB99691.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    ABLF02008636    GBBI01004410    JAC14302.1    GBBI01004408    JAC14304.1    GDHC01014268    JAQ04361.1    GDHC01014057    JAQ04572.1    ABLF02035780    ABLF02015138    GGMS01012504    MBY81707.1    GGMR01005823    MBY18442.1    ABLF02039606    ABLF02041863    ABLF02041670    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GGMR01014165    MBY26784.1    GDHC01011948    JAQ06681.1    GGMS01006636    MBY75839.1    GGMR01010723    MBY23342.1    GBBI01004276    JAC14436.1    GGMR01017784    MBY30403.1    GGMR01002024    MBY14643.1    GGMR01013370    MBY25989.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GBHO01037781    JAG05823.1    GDHC01019528    JAP99100.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GGMR01002421    MBY15040.1    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    GDHC01002235    JAQ16394.1    LBMM01009202    KMQ88311.1    GGMR01003717    MBY16336.1    GGMR01014351    MBY26970.1    GGMR01011131    MBY23750.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMR01008932    GGMR01010920    MBY21551.1    MBY23539.1    ABLF02006304    ABLF02036268    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    GBHO01028617    JAG14987.1    GGMS01009443    MBY78646.1    ABLF02028666    ABLF02066713    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    ABLF02036131    ABLF02041527    ABLF02064049    GGMR01009860    MBY22479.1    GAMC01020552    JAB86003.1    ABLF02067195    ABLF02041650    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    GGMS01014951    MBY84154.1    GBHO01037676    JAG05928.1    ABLF02005251    ABLF02055296    ABLF02006784   
Pfam
PF18701   DUF5641        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF13774   Longin
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR011012   Longin-like_dom_sf       
IPR010908   Longin_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR017907   Znf_RING_CS       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF64356   SSF64356       
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=0.0459652,     Score=89

Ontologies

Topology

Length:
817
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0381000000000001
Exp number, first 60 AAs:
0.03245
Total prob of N-in:
0.00178
outside
1  -  817
 
 

Population Genetic Test Statistics

Pi
4.716823
Theta
39.797414
Tajima's D
0.381331
CLR
106.401465
CSRT
0.476726163691815
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号