SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11055
Annotation
PREDICTED:_uncharacterized_protein_LOC107046166_[Diachasma_alloeum]
Location in the cell
Nuclear   Reliability : 3.024
 

Sequence

CDS
ATGTCACATTCCGTGAAGCGGAAGGTATCGTGTGCTGTACTTAAGAAAAGTAAATCGAGGTCGATGGACACAGATGAAATTTCGGTTCAGGACCTACCAGTATTGCGACGTAAGCGTACTTTATCTTTAAATCGATTAAAGAAAACATTAGTTATTGCCCGAGCGGCTAAATATGATCCGGAACAATGTAACACCTTCCTTGCTTGTTTTCCGGAAGTAAAAAAAGTTGTTAGTGCCTTTGAGGCTGCATACGGTGACATTATATCACTGATAGACAGTTGCGATGAGGAGGCTGAGGACCTGCTTCGCATGGAATTTGATGATACTCATATGGAGATTCTTTCTATATATCGGCAGTTGACTATCAAAACGGGTAGTGAATTGAACACTTCGCTAGAATCTTCCAAAGTAACAAGTCACAACATAAAACTTCCTAAAATTTCTGTACCGCTGTTTTCAGGTGAAATAAAAGGCTGGCCTAAATTCCATGACGTATTCCACTCCCTCATTCATAACAACGCAACACTTACGGACTCAGAGCGTATGCATTATCTAATATCAAGTTTGTCTGGAGATGCCGTGGCACTCATACGCTCCTTCCCTTATGAAGGGAAATTCTATCAGGAGGCTTATCAAACATTGATTGATCGTTATCAAAATAAGCGTGATTTAGCTTTCACCTGTTGGAAAGAAGTACTTAATAACCATCACACGCTTCTCCATCGAGATTTGTGTGACACTGACCGCGAGGACGTAGCCAAGAGTCATGTATCGATTAATCGACTGCCACCGTCTTCTTCTAGTCAAGAGCCACAAACGCAGGCTTTTACAAACATGAATGGTAGCTCTGTAGTTCTGCTGGCTACTGCTAACGTTGAAGTGCGCGACTCATCTGGTCACTTTCATACTCTTCGCGCACTCATCGACCCTGGTAGTCAATCACATTTCATTTCTAATCAAGCTATGGAACGATTGGGCTTAAAGCCTAAGCAAACTTCGCGAAATGTTTGTGGCTTGGGGCAATCATCGACGTCAGTGACTGGAATGGTGGAGCTTCAACTCGGAGTTCATCAAAAGAATTTATTTCATTTAACGGCTCTCATCTTACCATCTATTTGTGCACAAATGCCCACTGCTCGTCTTGATCTTTCTTCATGCGAACACCTACGTAATTTGCGACTCGCTGATCCGAATTATAATAAGCCTGGACCAATAGATCTGCTTATCGGTGCTGAAATGTTTTCAACGCTGTTACTGCCCGGAAATATTTCAGGTAGTCCTCATGAACCCTCAGCCTTGAACACCATCTTCGGATGGATCCTGATGGGAAGTGTCAAATGCAGGGATGAGACAAAACACTCAAATTCTTTTTTTCTAAGAGAACACGATACACCTCTCCATGAGGAATTGAGGAGACTGTGGGAGTTGGAGGTCATACCTAAATCATCAGTTCTAACGCCGGACGAGCAGCAATGTGAGAAACTTTTCACTGAAACCCACGCTCGAGGTACATCTGGAAGGTACATCGTTTCTTTGCCGTTTAGGCAGAGGGATGGGGAGTTACAGTTTCCGGGTTCGCGTGAAAATACATTGCGAAGATTCCATTCATTGGAACGAAGACTTCTTTCAAGTCCAAACCTTCATCAGCAGTATTCGGACTTCATGCTGGACTACTTACATAATGGTCATAGGAGTATCCTTTTATATGCTAAGTCTCGCGTGGCCCCAATTAAGAGAGTTTCATTGCCGAGACTAGAGCTCTGCGCTGCGGTTCTGCTCGCTGACCTGCTCAAATTCGTAAAAGAAGTGTATGTACCGTTACTTCCGTTTTCTGATACATTTGCTTGGTCAGATTCAACGGTAACTCTGTCATGGATTCGTGGCCATTCCTCGCGTTGGAAAACATTTGTTGCTAATAGGGTTAGTCATATCCAAGAAACTGTCCCCGAAACTCACTGGAATCACGTGCGCTCTAATGAAAATCCTGCGGACATAGCTTCCCGCGGTATGTGTCCGAGCGACCTACTCCAGAGTGAGTTATGGTGGGCGGGACCGAGCTGGCTTCGGCAACCTTCATCTTCATGGCCTTCAAATTCCGGTCTCGAGGTGAACGAGACTGATATACTTGCCGAGGAACGCTGTTTTTCGTTGGTCGTGAATGATGAACCTAACTTTATCGATTCTTTGCTCGAAAGGTTTTCATCAATTCGTAAGGTTCAACGTATTATTGGTTATTGTCTTCGTTTTATCAGAAATGCTAACAAAAAACAGACACGTGTTCCGGGTACCTTTTTAGGTCGTACAGAACTTCATGGGGCCCTGATGACGATTACCAAGCGAATTCAATTTCTCAACTTTCAGGATGAAATTCGTAAGCTCGAGAATGGTATACCATTACCCAAACCGTGGAGAAAACTCAATCCATTCCTGGACGACCAAGGAGTTGTCAGGGTGGGCGGCCGTTTGTCTCGTTCTGGTCTTGAGTTTAGTCATAAGCATCCTGCTCTGTTGCCGCGTCATTCTAGGTTCACATACATGATCATCGAAGCAATTCACAAAGAGAATTGTCATCCTGGGTTGGGAACGACACAATATCTTTTGATGCAGCTGTTTTGGAGAGCAAAGTGGAACAAAAGGGGCGAAACTTTGAATGATGGTTCTGTTGTACTGATTAAGAGTGAAAGTACAATGCCATTGCACTGGCCTTTAGCTCGTGTCTCCAAGCTTCACGCCAGCCCTGATGGCGTGGTTCGTATTGCCACTGTCCGTACAGCCAATGGCAAATTCTACACTAGGCCATTAACGAAGTTAGCTCCCTTACCTATTTATTCTGATTAA
Protein
MSHSVKRKVSCAVLKKSKSRSMDTDEISVQDLPVLRRKRTLSLNRLKKTLVIARAAKYDPEQCNTFLACFPEVKKVVSAFEAAYGDIISLIDSCDEEAEDLLRMEFDDTHMEILSIYRQLTIKTGSELNTSLESSKVTSHNIKLPKISVPLFSGEIKGWPKFHDVFHSLIHNNATLTDSERMHYLISSLSGDAVALIRSFPYEGKFYQEAYQTLIDRYQNKRDLAFTCWKEVLNNHHTLLHRDLCDTDREDVAKSHVSINRLPPSSSSQEPQTQAFTNMNGSSVVLLATANVEVRDSSGHFHTLRALIDPGSQSHFISNQAMERLGLKPKQTSRNVCGLGQSSTSVTGMVELQLGVHQKNLFHLTALILPSICAQMPTARLDLSSCEHLRNLRLADPNYNKPGPIDLLIGAEMFSTLLLPGNISGSPHEPSALNTIFGWILMGSVKCRDETKHSNSFFLREHDTPLHEELRRLWELEVIPKSSVLTPDEQQCEKLFTETHARGTSGRYIVSLPFRQRDGELQFPGSRENTLRRFHSLERRLLSSPNLHQQYSDFMLDYLHNGHRSILLYAKSRVAPIKRVSLPRLELCAAVLLADLLKFVKEVYVPLLPFSDTFAWSDSTVTLSWIRGHSSRWKTFVANRVSHIQETVPETHWNHVRSNENPADIASRGMCPSDLLQSELWWAGPSWLRQPSSSWPSNSGLEVNETDILAEERCFSLVVNDEPNFIDSLLERFSSIRKVQRIIGYCLRFIRNANKKQTRVPGTFLGRTELHGALMTITKRIQFLNFQDEIRKLENGIPLPKPWRKLNPFLDDQGVVRVGGRLSRSGLEFSHKHPALLPRHSRFTYMIIEAIHKENCHPGLGTTQYLLMQLFWRAKWNKRGETLNDGSVVLIKSESTMPLHWPLARVSKLHASPDGVVRIATVRTANGKFYTRPLTKLAPLPIYSD

Summary

Pfam
PF05585   DUF1758        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF03564   DUF1759
Interpro
IPR008042   Retrotrans_Pao        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
945
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01532
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00078
outside
1  -  945
 
 

Population Genetic Test Statistics

Pi
469.421061
Theta
227.005695
Tajima's D
3.553926
CLR
0.388814
CSRT
0.994600269986501
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号