SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11049
Annotation
hypothetical_protein_ALC57_15604_[Trachymyrmex_cornetzi]
Location in the cell
Nuclear   Reliability : 3.078
 

Sequence

CDS
ATGTCAGAATATTGTTTTATTTGTACTCATCTTTTAACTGAAAGTGAAACTGTAACTGTTGATCGTGGTATGAAGACACTGATTAATGCAAGTGCTGAAAGAGATGATGGATACTCGGAATTTCTTAAAAAACAAAAATCTGTGACAATACATAGCAACTGTCGTAAAATTTATACGCGGAAGTGTTCTATTGCTGCTGCCATCAAAAGAAAACGCGAAGAACAAGAAGCTAACACATCTACAGGATCTACAGTAAGTAGTCCTCCTCGTACTAGATCCCGTTCAAGTGATTCAGCTTTTTGTTTTAAAAAACTATGTTTATTTTGTGGCAATAAATTGAATGAAGAGTTGCAGAGAAAAAAATCCTTAGATCGTCGCAGTAAAATTTGTCAAGTAAGTACACTCCAATTCAAACATTCAATTTTGGAAGTAGCACGAACTCGTTCCGATGCTATATCGAAAGCTGTTGTTGCTCGAATCGAATTTGACTATGATTTAGTTGCTGCTGAAGCAAAGTATCACCAAGAATGTTATACTTCTTTTTTGAAACCGACTACTGGCGGTACAGTTGGTCGTCCTAAAGATGAAGCAACAGATCTGGCAATGCAGGAAATATTTACATACATTGAGAGTAGCAATGACTGTCAGTTTACTTTGGCTGAGTTAAAAGATGTTAGCAAAATTTTAACTTTAGATAACAGGACTATTAAGCTGCGACTTAAACTGAAATATGGCGATAAAATTATTATCACTGAAAAACCGGGAGCGTTAACATTTGTATGTTTGATAAACAGTCACCATGAAATTTTAAATCAATCTTGGTCCGAAAATAAAAAAATTAATAAACAAGAAGAACGATTAAAAACTCTAGAAGCAGCAGCATCTATTATTCGAGAAGATATTCAATCCTCGGTATTTGATAATTCCTACTACCCTCCACCAGGTCGAATGTTTGAAGATTTAAATAATGACATCCCACAGTCACTGACATTTTTTTTGGAGCAAATGATCTTAAAAAATAAACGATCAAATTTCGATCATTTAAAACTAGTATGCACCAATATTTGTCATAGTATCATGACTGCTATTCGACCAAGATCGTTCAAGTCCAAATTACAGTTAGATCTTTCAGTTTTTTTTCATCGGAGGTTCGGGTCTAAGCGTCTTATACAAATTTTGTCGTCTTTTGGTTTGTGTGCTTCTTATAATGATACATTGATGTACGAGTCAGCAGCAGTTTTTCATCCTCTTCCTCATGTCCTACCACCTGAAAGTGGCACACTTATTCAATACGTTGCAGATAATGCTGATATAAATGTTAATACGCTAGACGGTAACAATTCACTCCACATAATGGGTATAATTCAAATTGTAACTCCAAAGCACTCTGTTTTACTAGAAGAACCTATGCAACGAATAAAAGAAGTTCTTTCAGCAAAACACTTCAAAGCAAAAGCTCATGTGCCAATACAGATCTATCAGAATAGTGATGTAGTTGGTTACAGTAAAATATATGTCCAAGATTTTGGATATGGAACTGAAACAGTATCTTTTCATAAAAATTCTGATGTAGTATGGTTTTATGGAAAGTGGAAAAATACATCATTACCTGGTTGGAACGGTTTTATTGAGCGCTTAACAAATTACCATACAAATTATTCAAAATCTCAGATTACATTTTTACCATTCATCCATCAACCAGCTAGTAACTATAATACTGTCTATACGACTTTACTTTGTGCATTAGAGAACGCGAAACGTTACGGCCACACTGTATGCATCGTGACTTTCGACCAACCCTTGTATGCGAAAGCTCGAGAAATTGTATCAGCCGCACCTGACGGCTCTGAAGTATCGAAGATTATTGTCAGACTTGGAGGATTTCATCTACTCATGTCTTATCTCGGAGCAATTGGTTATATTATGCAAGGTAGCGGGATAAAAGAAGTACTCTCAGAAATCTATGCACCAAAGTCATTAGAAAAAATGCTCAATGGTCATGCTTACGCAAGAGCTGTTCGAGCACATACACTACTCCAGCTGGCTTTAGCAATTACAATATTAAAAACAATAGATATTAATGATATCATGGGAGCAGATTTAATCATAAATATTGACCATATATTAGATAGCACTCTTTCATATTCAGATATTGAAAATGATAATGAAGTATCAGGACATTTTCCATATGCTAAATCTGCACACTTGTATTTACAAGACATGATGCAATTACAGGACTCGATGGATCCTGAAGTTTACGAAAAATTTACCGAAGGATTTTTCACCGTGAGACGCTCAGATAAATTGAGTTGTGGAACTTCTACAGACATGGTTATCGAACAGTCTATGATGAAAGCCATGAAGACAGATGGAGGTATTGCTCGAGGAAGAAGTACAAAACAAAGTGTAATCAGTAAATGGGTTTACAGCATGCATGCAATGAACACAGTTTGTGAGAAATTAGAAGATCTTGCTAATGTTAGGATGGATACGACTGAACAGCATGTTGATGCCAGTGATTCACGTGTAAAAAAAGACGCTAAAGACATACGAATGCTTCTTGAGTGGTTCTCGATTCATGATCCTTTCCCAGAGGTTAACAAAGTCATCTCGATTGCAAGTGGTGTCGTTGGTGATAATACAATTAATTGCTATAAAGCACGTGAACTTGGGCTTATCTCTATTGCTAAAATAACTGGACTGACATTTAAAGATATTAAACTTAAACGCGCTGACAAAGTTGTTCCTCTTTTAGCTATGAGTAGCACCGTAAAAGTTCACGAAGAAAAAGTACCTGTTGACCCAGTGTTATTATTCCAACGTATGAGTGTTACTGCGGCTTTTCAAGATGAAATTGAGAAATATTTCGAGTATGAATTAGCTCCTTATCCGTTAACATTATTTGATGACATTGGAATGCGCAAGACCCAGAAGTCGGCTATTTACGATTGTTTTCAGACTATAAATGTTGATATTAATAACACTAATTCAACGTACATAATTGACGGAGGATTCTTATTACATCGAGTGGTGTGGGATAGCGAGGAAACATTTAACGTTATCTTAGATAAATACGTTCAATATGTACGTCGACATTTTGGTTCCAGAGTTACTGTCGTATTTGACGGATATGATGATTATACGAGAAATATTAAAGCAGCAGAGCAACGCCGTCGAAATGCTGCTTCATCAACTTCTTCTGATATTATATTCGATGAATCAATGACAGTTCCTACCAGTCAACAGAAATTCTTTGCAAATAATCACAATAAATCTAGGTTTATTTCGATGTTGAAAGCAAAATTTACTGCTGAGAATATATCCGTTGAACAAGCTAATGATGATGCTGATGTATTGATTATTGAAACAGCGATAAAGAAATTCAGTGTGACAAATACAACTGTTGTTGTTGGTGAGGATGTTGATTTACTCGTCTTGCTTACTGCTCGAACTCCAACTGAAAAAATTATTTATTTTTTTAAACCCGGAAAAGCCCAAAATCAATCGGAAATATATTCATCAAACAGTTTATCCAATTTTCCTAAATGTCAAAATCATGTATTGTTTCTACACGCAATAACTGGCTGCGATACGACATCTGCTTTTTACAGGAGAGGAAAAACAACAGTTTTCAAAATGTTTGAAAAAAAAGATTTACTACAATGTGCTGAAGTTTTTAAAAATAGTAATTCAACTCAACAACATGTTATCACCAACGGAGTTCAATTTCTTCTTGCTATGTACGGAGCCCCCAAAAAAACCACTTGCTTAGATAAGTTGCGATACACATCTTTCGTGAAAAATACGCGTAATAAAAAACAAGTCAACTTAGCTTCTCTTCCTCCAACCTCAGTAGCTGCTCATCAACATCTGTTTCGGGTATATTACCAAGTTCAAGTGTGGCTTGGTAATCAGCTGGACCCTAAAGACTGGGGTTGGAAGTTGATCGACAATACACTAGAGCCAGTTCAAACTTTACTTCCACCAGCACCTGAGAAACTTCTCAACACAATATTTTGCAACTGCAAGAAAGGATGTAGTGCAAAATGTGGTTGCAGAAAAGTTGGACTGTTTTGTTCCCTGGCATGCACACACTGTCAAGGCCGATCATGCTCGAATGTTGAGTCACCAACTCTTGAAGATTCGTTTGATACCGATCAGGAATCGCTATTGGGGCAGTTTACGTGTGAAATAGAACAAGAAGAAGAAGAAGAACAAGAGGATGAACAGGAAGAAGAAGGAGAAGAAGATCAAGAAGAAGAAGAAACAGAAATCTTGGACAGTTATGAATCAGACGACTAA
Protein
MSEYCFICTHLLTESETVTVDRGMKTLINASAERDDGYSEFLKKQKSVTIHSNCRKIYTRKCSIAAAIKRKREEQEANTSTGSTVSSPPRTRSRSSDSAFCFKKLCLFCGNKLNEELQRKKSLDRRSKICQVSTLQFKHSILEVARTRSDAISKAVVARIEFDYDLVAAEAKYHQECYTSFLKPTTGGTVGRPKDEATDLAMQEIFTYIESSNDCQFTLAELKDVSKILTLDNRTIKLRLKLKYGDKIIITEKPGALTFVCLINSHHEILNQSWSENKKINKQEERLKTLEAAASIIREDIQSSVFDNSYYPPPGRMFEDLNNDIPQSLTFFLEQMILKNKRSNFDHLKLVCTNICHSIMTAIRPRSFKSKLQLDLSVFFHRRFGSKRLIQILSSFGLCASYNDTLMYESAAVFHPLPHVLPPESGTLIQYVADNADINVNTLDGNNSLHIMGIIQIVTPKHSVLLEEPMQRIKEVLSAKHFKAKAHVPIQIYQNSDVVGYSKIYVQDFGYGTETVSFHKNSDVVWFYGKWKNTSLPGWNGFIERLTNYHTNYSKSQITFLPFIHQPASNYNTVYTTLLCALENAKRYGHTVCIVTFDQPLYAKAREIVSAAPDGSEVSKIIVRLGGFHLLMSYLGAIGYIMQGSGIKEVLSEIYAPKSLEKMLNGHAYARAVRAHTLLQLALAITILKTIDINDIMGADLIINIDHILDSTLSYSDIENDNEVSGHFPYAKSAHLYLQDMMQLQDSMDPEVYEKFTEGFFTVRRSDKLSCGTSTDMVIEQSMMKAMKTDGGIARGRSTKQSVISKWVYSMHAMNTVCEKLEDLANVRMDTTEQHVDASDSRVKKDAKDIRMLLEWFSIHDPFPEVNKVISIASGVVGDNTINCYKARELGLISIAKITGLTFKDIKLKRADKVVPLLAMSSTVKVHEEKVPVDPVLLFQRMSVTAAFQDEIEKYFEYELAPYPLTLFDDIGMRKTQKSAIYDCFQTINVDINNTNSTYIIDGGFLLHRVVWDSEETFNVILDKYVQYVRRHFGSRVTVVFDGYDDYTRNIKAAEQRRRNAASSTSSDIIFDESMTVPTSQQKFFANNHNKSRFISMLKAKFTAENISVEQANDDADVLIIETAIKKFSVTNTTVVVGEDVDLLVLLTARTPTEKIIYFFKPGKAQNQSEIYSSNSLSNFPKCQNHVLFLHAITGCDTTSAFYRRGKTTVFKMFEKKDLLQCAEVFKNSNSTQQHVITNGVQFLLAMYGAPKKTTCLDKLRYTSFVKNTRNKKQVNLASLPPTSVAAHQHLFRVYYQVQVWLGNQLDPKDWGWKLIDNTLEPVQTLLPPAPEKLLNTIFCNCKKGCSAKCGCRKVGLFCSLACTHCQGRSCSNVESPTLEDSFDTDQESLLGQFTCEIEQEEEEEQEDEQEEEGEEDQEEEETEILDSYESDD

Summary

Interpro
IPR029060   PIN-like_dom_sf        + More
IPR007527   Znf_SWIM       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF88723   SSF88723        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1433
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12844
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00088
outside
1  -  1433
 
 

Population Genetic Test Statistics

Pi
165.480797
Theta
148.647421
Tajima's D
-0.917951
CLR
12.262329
CSRT
0.156242187890605
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号