SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11035
Pre Gene Modal
BGIBMGA002329
Annotation
PREDICTED:_uncharacterized_protein_LOC105254802?_partial_[Camponotus_floridanus]
Full name
ATP-dependent DNA helicase      
Location in the cell
PlasmaMembrane   Reliability : 2.131
 

Sequence

CDS
ATGCATCGTGTAAACGAGACACATCGTTTGTACGATGCGTTACAATATCCAATCATTTATTGGCAAGGACAAGACGGATACGACATCACGTTGAAGATGGTCGATCCAATTACAGGCGTATCAACGAATAAAAATCTAAGCGCAATGAATTACTATGCGTATCGTATGATGATTCGTACACATGAGGAGAATGTCATTCTGAAGTGCCGTCGGCTATTCCAGCAATTCGCTGTCGACATGTATGTCAAAGTCGAGACCGAACGTTTAGCGTTCATCCGATTCAATCAGGCAAAGCTACGATCTGAGGACTATATACACTTGCGTGATGCTATTCATTCAGATGGTGATGTTCAAAATATTGGACGTCTGACGATTCTCCCATCATCTTATATCGGAAGCCCACGCCACATGCACGAATACGCTCAAGACGCTATGACGTACGTGCGAAATTATGGAACTCCGGATTTATTTATTACGTTCACATGCAATCCGAAGTGGACGGAAATTGAACTTAAAGTTCAAAATCAAGAGATTGAGATCGGAAATGAATTCATTGTACCATATTGCCCGCTGCTATCAAGAATTTTCGAAACACATGCAAACGTTGAGAGTTGTCATTCGGCCAAATCAATCAAATATTTGTGCAAGTACGTCACAAAAGGCAGCGACATGGCTGTGTTTGGTATTGCGTCGGAAAATGCCAATGATGAAATCAGTAACTTCCAAATGGGCAGATACGTTAGTACTAATGAAGCACTGTGGCGATTATTGTCATTTCAAATTCATGAAAGATATCCCACAGTTGTACATTTAGCAGTGCATTTGGAAAATGGCCAAAGAGTTTACTTCACTGAGGCTAATGCGGCACAACGAGCTGAAAGACCACCATCGACAACATTGACTAGCTTCTTTGCAATGTGTGAAGCAGATCCATTCGCAGCGACGCTGATGTACGTTGAAATGCCCAAGTATTACACTTGGAATCAATCAACAAAGAAATTCCAACGTCGCAAACAAGGAACCCCAGTTCCAGATTGGCCACAGGTGTTTTCCACTGATGCACTAGGTCGCATGTATACTGTTCATCCTAGAAATGACGAATGTTTTTATTTGCGACTGCTGCTGGTAAATGTACGTGGACCAAAATCATTTGCGCATTTGAAAACTGTGAATGGCCACCAATGCCAAACATATCGAGAAGCATGTCAACTATTGGGTTTGCTGGAGAACGATTCTCATTGGGATTTAACACTTGCGGATTCAGTTGTTTCATCAAATGCGTACCAAATACGAACGCTGTTCGCAATTATCATCACCACATGTTTTCCTTCACAACCAATTCAGTTATGGAACAAATTCAAAGACGACATATGTGAAGATATCTTGCATCGCTTGCGCATTCAAACGAATAATCCTGACATCCAAATAACCGATGAAATCTACAATGAAGGATTGATTCTGATTGAGGATCAATGCTTGACTATTGCAAACAAGTTACTGATTGAAGTAGGAATGATTGCGCCAAATCGATCGATGCACGATGCATTCAACCAAGAATTAAATCGAGAGCTGCAATACAATGTTGATACATTGCAGGAATTCGTGCGAAATAATGTGCCGTTACTGAATGAACAGCAAAAACAAGTATACGAAACATTAATGCAAGCGGTGGACAATAATACTGGTGGTCTATTCTTCCTGGACGCACCTGGAGGAACAGGGAAAACATTTGTCATTTCATTGATTTTGGCCACTATTCGATCAAGATGTGACATAGCTTTGGCGTTAGCATCATCTGGAATTGCGGCGACTCTTCTAGACGGCGGTCGTACTGCACATTCTGCGCTTAAGTTGCCACTCAATTTAAACACAATTGATACTCCAACATGCAATATTTCCCGATCCAGTGCAATGGGAAAATTGTTGATGCAATGCAAGCTCATTGTTTGGGATGAGTGCACAATGGCACATAAGAAATCACTTGAAGCACTTAACTTCACACTGAAGGATCTTCGGCGAAATAACAACATCTTTGGTGGCTTGATGATATTGTTGGCAGGCGATTTCAGGCAGACGTTGCCAGTAATTCCCCGTGGAACGCCTGCAGATGAATTGAATGCTTGCCTGAAGGCATCACCTTTATGGAATAACGTAAAAACATTATCGCTAGCCACTAATATGAGAGTTCAACTTCAAAATGATCAAAGTGCTGCACCATTTTCCAAACAATTGTTAGCTGTTGGAAATGGAAAAGTCCCAGTTGATGCGACATCTGGATTAATTACTCTTACCAACGACTTTTGCCGATTTGTAGACTCTCAATTAGCTCTTATTGAAAATGTTTTCCCAAACATTAGTGAGAATTATCAGAATTATGCTTGGTTAAGTCAACGAGCAATTCTTGCCGCAAAGAATAATGATGTACACGCACTGAATTTCACCATTCAATCAAAAATTGCTGGCGATTTGGTGACATACAAATCCGTTGATTCCATAACAAATCCCGATGATGTAGTAAATTATCCAACGGAGTTTTTGAACTCTCTGGAGTTGCCAGGATTTCCACCACATAACTTGCAACTCAAAGTTGGTACAGAGCACTTCAATGAAACGGATAATTTGCGGACACGTATAACGCTTCGATTCAGTATTTACTTTGGATTCACTTTCATTTACTTAGAGAAGTTCAACTAA
Protein
MHRVNETHRLYDALQYPIIYWQGQDGYDITLKMVDPITGVSTNKNLSAMNYYAYRMMIRTHEENVILKCRRLFQQFAVDMYVKVETERLAFIRFNQAKLRSEDYIHLRDAIHSDGDVQNIGRLTILPSSYIGSPRHMHEYAQDAMTYVRNYGTPDLFITFTCNPKWTEIELKVQNQEIEIGNEFIVPYCPLLSRIFETHANVESCHSAKSIKYLCKYVTKGSDMAVFGIASENANDEISNFQMGRYVSTNEALWRLLSFQIHERYPTVVHLAVHLENGQRVYFTEANAAQRAERPPSTTLTSFFAMCEADPFAATLMYVEMPKYYTWNQSTKKFQRRKQGTPVPDWPQVFSTDALGRMYTVHPRNDECFYLRLLLVNVRGPKSFAHLKTVNGHQCQTYREACQLLGLLENDSHWDLTLADSVVSSNAYQIRTLFAIIITTCFPSQPIQLWNKFKDDICEDILHRLRIQTNNPDIQITDEIYNEGLILIEDQCLTIANKLLIEVGMIAPNRSMHDAFNQELNRELQYNVDTLQEFVRNNVPLLNEQQKQVYETLMQAVDNNTGGLFFLDAPGGTGKTFVISLILATIRSRCDIALALASSGIAATLLDGGRTAHSALKLPLNLNTIDTPTCNISRSSAMGKLLMQCKLIVWDECTMAHKKSLEALNFTLKDLRRNNNIFGGLMILLAGDFRQTLPVIPRGTPADELNACLKASPLWNNVKTLSLATNMRVQLQNDQSAAPFSKQLLAVGNGKVPVDATSGLITLTNDFCRFVDSQLALIENVFPNISENYQNYAWLSQRAILAAKNNDVHALNFTIQSKIAGDLVTYKSVDSITNPDDVVNYPTEFLNSLELPGFPPHNLQLKVGTEHFNETDNLRTRITLRFSIYFGFTFIYLEKFN

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
EMBL
RSAL01000338    RVE42429.1    BABH01039432    GAIX01013838    JAA78722.1    HQ009558    + More
AEE09607.1    RSAL01001639    RVE40746.1    KE126587    EPB66060.1    JARK01000714    EYC35207.1    KN739487    KIH54222.1    KN739098    KIH54434.1    KN743176    KIH52626.1    NIVC01000229    PAA87485.1    NIVC01001445    PAA67902.1    NIVC01000366    PAA84583.1    NIVC01000111    PAA90396.1    NIVC01001359    PAA68995.1    JOJR01000111    RCN45090.1    KN726708    KIH67418.1    ABLF02016932    JOJR01000723    RCN34924.1    ABLF02041819    NIVC01001486    PAA67379.1    ABLF02024220    ABLF02041348    ABLF02020814    ABLF02049665    ABLF02018127    NIVC01004230    PAA48122.1    NIVC01002034    PAA61410.1    NIVC01001383    PAA68602.1    NIVC01000419    PAA83453.1    JEMT01022708    EXX64911.1    NIVC01000175    PAA88803.1    NIVC01004666    PAA46875.1    NIVC01000381    PAA84309.1    NIVC01001722    PAA64736.1    NIVC01001945    PAA62370.1    NIVC01003989    PAA49045.1    BDIQ01000010    GBC12419.1    NIVC01002018    NIVC01001743    NIVC01000051    PAA61561.1    PAA64516.1    PAA92464.1    BEXD01001738    GBB95559.1    NIVC01000042    PAA92669.1    NIVC01001115    PAA72069.1    BDIQ01000188    GBC50999.1    BDIQ01000091    GBC29771.1    LR031875    VDD29751.1    HG002121    CDF40068.1    KN818726    KIL54493.1    KZ305018    PIA64450.1    AGNK02004404   
Pfam
PF05970   PIF1        + More
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
Interpro
IPR025476   Helitron_helicase-like        + More
IPR010285   DNA_helicase_pif1-like       
IPR027417   P-loop_NTPase       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
IPR003840   DNA_helicase       
IPR003323   OTU_dom       
SUPFAM
SSF52540   SSF52540        + More
SSF54001   SSF54001       
PDB
5FHH     E-value=8.36803e-05,     Score=113

Ontologies

Topology

Length:
897
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.5988
Exp number, first 60 AAs:
0.00236
Total prob of N-in:
0.00091
outside
1  -  897
 
 

Population Genetic Test Statistics

Pi
17.151575
Theta
35.847552
Tajima's D
0
CLR
249.213702
CSRT
0.369281535923204
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号