SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10983
Pre Gene Modal
BGIBMGA008511
Annotation
PREDICTED:_semaphorin-2A-like_[Amyelois_transitella]
Full name
Semaphorin-2A      
Alternative Name
Sema II
Semaphorin-II
Location in the cell
Mitochondrial   Reliability : 1.11 PlasmaMembrane   Reliability : 1.18
 

Sequence

CDS
ATGAAAAGAATTCCACGTGAACAGTCGCAGTTCGACGCTTCACTAAGCTTTGCCTTTTATGAACGTCGTGTTCTGAAGAATGTTAATGGTGTTTTTATAAAGATTGCGAATTCGGAATCTAGCTCGATTAAGATTAAGCAAATTTCAAGTGAACTGAGATTTAAATGTACAAAAACCAAGATCCACCAAGATCTAAAGGCAATTTCCTTCTTTACAGATCATGTACGGGAATTTTCCTGTGGCGCCTTGTACTACAGGACCTTCTTTGTTGACTCGAAAAGGGATGCACTCTATGTTGGCGCTATGGATCGGTTATATCGGCTGAATATGAATAACATTAGTGCGTCGCATTGCGAAAGAGATTCAATTAACCTAGAGCCTAGCAACGTGGCCCAATGCGTATCCAAAGGAAAATCAGAGCATTTCGACTGTCGAAACCACATCCGTGTAATTCAACCTATGGGCGACGGATCACGCCTGTATGTCTGCGGTACCAATGCTCACAGCCCGAAGGATTGGGTCTTATATTCGAACTTGACGCACCTGCCTCGTTACGAGTACGTGCCGGGCATAGGGATGGGGGTTGCAAAATGCCCGTATGATCCAGCGGACAACTCTACTGCTTTGTGGGTGGAGAAGGGCAACCCTGGCAACCTGCCCGCACTGTACTCGGGAACTAACGCCGAATTCACCAAAGCCGATACGGTGATCTTCAGAACGGATTTGCATAACTTGACGACGGGACGACAAGAGTTTTCCTTCAAGAGAACTCTGAAATACGACTCGAAGTGGCTCGACAAGCCTAACTTCGTTGGATCATTTGATGTTGGTGAATACGTTCTATTTTTCTATCGCGAAACGGCTGTGGAGTACATTAATTGCGGCAAAGCTGTGTATTCGAGGGTGGCCAGAGTCTGTAAGAGGGACACAGGAGGCAAGAACATTTTGAGCCAAAACTGGGCAACTTACTTGAAAGCCAGACTAAACTGCAGCATACCCGGAGAATTTCCATTTTATTTTAATGAAATACAGAGCATTTATAAAATTCCCGGCGACGACAGCAAATTCTATGGTGTTTTCACAACAGCTTCGACTGGTCTCATGGGATCTGCGATTTGCACCTTCACTATCGGAGATATCCAGAAGGCTTTCGAAGGGAAATTCAAAGAGCAGGCTTCCTCCAGCTCTGCTTGGCTTCCGGTCATCACCAGCAAAGTACCGGAACCTAGACCGGGGACTTGTGTGAATGATACGGCATCTCTGCCAGACACAGTTCTGAATTTTATTCGGTCACATCCCCTTATGGACAGTGCCGTTTCCCATGAACATGAAAAACCGATTTATTACAAAAGGGACTTGTTCTTCACGAGACTTGTGGTAGACAGAGTGAAGGTCGACATGATGGGACACCAGCTGGACTACACCGTGTATTATGCTGGAACAAGTAAGTGTTTTAATGTTAATTGCGTGCAGTTAAAATCTTAA
Protein
MKRIPREQSQFDASLSFAFYERRVLKNVNGVFIKIANSESSSIKIKQISSELRFKCTKTKIHQDLKAISFFTDHVREFSCGALYYRTFFVDSKRDALYVGAMDRLYRLNMNNISASHCERDSINLEPSNVAQCVSKGKSEHFDCRNHIRVIQPMGDGSRLYVCGTNAHSPKDWVLYSNLTHLPRYEYVPGIGMGVAKCPYDPADNSTALWVEKGNPGNLPALYSGTNAEFTKADTVIFRTDLHNLTTGRQEFSFKRTLKYDSKWLDKPNFVGSFDVGEYVLFFYRETAVEYINCGKAVYSRVARVCKRDTGGKNILSQNWATYLKARLNCSIPGEFPFYFNEIQSIYKIPGDDSKFYGVFTTASTGLMGSAICTFTIGDIQKAFEGKFKEQASSSSAWLPVITSKVPEPRPGTCVNDTASLPDTVLNFIRSHPLMDSAVSHEHEKPIYYKRDLFFTRLVVDRVKVDMMGHQLDYTVYYAGTSKCFNVNCVQLKS

Summary

Description
Plays a role in growth cones guidance. Required for both proper adult behavior and survival. Can function in vivo as a selective target-derived signal that inhibits the formation of specific synaptic terminal arbors.
Subunit
Interacts with PlexB.
Similarity
Belongs to the semaphorin family.
Keywords
Developmental protein   Differentiation   Disulfide bond   Glycoprotein   Immunoglobulin domain   Neurogenesis   Secreted   Signal   Alternative splicing   Complete proteome   Reference proteome  
Feature
chain  Semaphorin-2A
splice variant  In isoform C.
EMBL
RSAL01000119    RVE46737.1    AGBW02012905    OWR44236.1    KQ459765    KPJ20039.1    + More
KQ971312    KYB29357.1    ADTU01003207    ADTU01003208    ADTU01003209    ADTU01003210    ADTU01003211    ADTU01003212    KK107168    EZA56161.1    EU836737    ACJ23177.1    KYB29356.1    GEZM01010724    JAV93879.1    GEZM01010727    JAV93876.1    GEZM01010726    JAV93877.1    KQ434772    KZC03927.1    EF036538    ABK35089.3    AAZX01003580    AAZX01006728    AAZX01007460    AAZX01008558    AAZX01009344    AAZX01009609    AAZX01020005    GEZM01010725    JAV93878.1    KQ979074    KYN22979.1    GECZ01020839    GECZ01018246    JAS48930.1    JAS51523.1    GEBQ01014268    JAT25709.1    GBYB01009445    JAG79212.1    KQ459604    KPI92525.1    GEDC01028490    JAS08808.1    GBHO01015025    GBRD01015533    JAG28579.1    JAG50293.1    DS235306    EEB14535.1    GBBI01002318    JAC16394.1    AF134904    GFXV01001551    MBW13356.1    GGMR01013377    MBY25996.1    GDIQ01024602    JAN70135.1    ABLF02036314    ABLF02036316    ABLF02036319    ABLF02036320    ABLF02036322    ABLF02036323    ABLF02047241    ABLF02047629    ABLF02048663    ABLF02066977    GDIP01062188    JAM41527.1    GDIP01075879    JAM27836.1    GDIP01217514    JAJ05888.1    GDIP01111340    JAL92374.1    GDIP01217515    JAJ05887.1    GDIP01075878    JAM27837.1    GDIQ01266421    JAJ85303.1    GDIP01174818    GDIQ01268439    GDIQ01106037    GDIQ01059404    GDIQ01049163    LRGB01002993    JAJ48584.1    JAJ83285.1    KZS05205.1    GDIP01186221    GDIQ01116330    GDIQ01059403    JAJ37181.1    JAL35396.1    GEHC01000845    JAV46800.1    GDIQ01266422    JAJ85302.1    GL437072    EFN71160.1    GDIP01042284    JAM61431.1    GDIP01171022    JAJ52380.1    GDIQ01156059    JAK95666.1    GDUN01000846    JAN95073.1    GFDL01003077    JAV31968.1    CH477369    EAT42479.1    AAAB01008960    EAA11400.4    GAPW01000322    JAC13276.1    KQ976692    KYM77764.1    GDIQ01268438    JAJ83286.1    RSAL01000144    RVE45961.1    CP012524    ALC41677.1    KQ977355    KYN03331.1    CH916367    EDW01091.1    KQ982851    KYQ49896.1    GDIP01125839    JAL77875.1    GDIP01125889    JAL77825.1    CH940648    EDW62044.2    CH933808    KRG04686.1    CM000071    KRT01800.1    GBXI01012515    JAD01777.1    GAMC01016191    JAB90364.1    EDW09487.1    OUUW01000001    SPP73455.1    CH963849    EDW74013.1    KRF80399.1    KRF80400.1    SPP73456.1    CH902619    KPU77008.1    EDY68862.1    CH479181    EDW31848.1    CVRI01000054    CRL00153.1    GAMC01016189    GAMC01016188    JAB90366.1    EDV37742.1    KPU77009.1    KPU77010.1    GDHF01034064    GDHF01027113    GDHF01019851    GDHF01006112    GDHF01002618    JAI18250.1    JAI25201.1    JAI32463.1    JAI46202.1    JAI49696.1    CM000362    CM002911    EDX07372.1    KMY94279.1    CH480816    EDW48155.1    L26083    AE013599    AY095026    AY128437    BT011447    KMY94280.1    KMY94281.1    KMY94282.1    BT071804    ACN43740.1    CH954179    EDV55744.1    CM000158    EDW91909.1    GDIQ01132581    JAL19145.1    GDIQ01132582    JAL19144.1    KQS62451.1    KQS62452.1    KRK00203.1    KRK00204.1    KRK00205.1    GDIQ01040643    JAN54094.1    IACF01001160    LAB66876.1    GL732547    EFX80330.1    KQ459299    KPJ01990.1    ATLV01024426    ATLV01024427    KE525352    KFB51394.1    AGBW02013971    OWR42495.1    KQ460205    KPJ16922.1    EAA11003.5   
Pfam
PF01403   Sema        + More
PF00078   RVT_1
PF01437   PSI
Interpro
IPR001627   Semap_dom        + More
IPR036352   Semap_dom_sf       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR027231   Semaphorin       
IPR036179   Ig-like_dom_sf       
IPR013783   Ig-like_fold       
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR000477   RT_dom       
IPR002165   Plexin_repeat       
SUPFAM
SSF48726   SSF48726        + More
SSF101912   SSF101912       
Gene 3D
PDB
6FKN     E-value=4.20281e-73,     Score=699

Ontologies

Topology

Subcellular location
Secreted  
Length:
494
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
5.72845
Exp number, first 60 AAs:
0.00032
Total prob of N-in:
0.19776
outside
1  -  494
 
 

Population Genetic Test Statistics

Pi
212.270667
Theta
186.802819
Tajima's D
0.836888
CLR
0.52675
CSRT
0.615619219039048
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号