SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10982
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.182 Nuclear   Reliability : 1.397
 

Sequence

CDS
ATGGCGTTGGCGGAAGGGCCGGCGGCTGCTGCGGCGCCGCCCGCCACTGATTTTGAGAAGCCGTCGTCTTGCGGACTGGACGCTGCCTCCTCGGCGCAGTTCAAGGCCGCCTGCCGTGAGGCGAAAAATAAAAATAGGAAAATAGAAGAGGTTGAGCGCCTACAGCGATCCCTGACGGAGGTGGGTCCCTCTGACCCCCTCCGAGCTTGTAAAATAGTCGGGAAGATAGTCGCGACCATTGCGGCTAAATCCACTGGAGGCCTCAAGGGCACAGAAGTGTCGGCCATGAAATCGGCGGCCGCCACACTCGAGGAACGGCTGCAGGACGTTGTGGACCGCACCACAACCACAGAGACGGCAGGCCTGCGGCAGGAAATAGCCCTGCAGCACGCCCGCCTTGAGCAACTGGCGGAGGAAAATGGCCGACTTCGGGCGGAGAACGGACAGTTCCGCGTCGACATGGCCGAGCTGCGAACAATGGTTGCCGATCTCATCGAGCGGCAACGCAGCTCGGCCCCTGTCCTTCCTCCGCCCGAAGCAGAAGGCCTCACTGAGGTCGAGGAGCTGAGGCGGCAGCTCCTCATACAGGAAGCACGCAGCTCCAGGGTGGAGCGTGCGAGGCCGCCCCTCGCCCATGAGGCGAAAGGCAGTGCGCCCGTGCCAGCGCCCCGGAAAACAGTGGCCGTCAGAACTTATGGCGGCCCTGCAAAGGGCGCGACACCTGCGGCACGCCCGGTCGCCTCGGCTGCTGTTCCGGCCAAGCCTGGACCAACGGACCCGCGGAACCAACAAAATACGGGGGCACCAAAACCCGCCCCCTCAGGAGCACCAGTCACCGGCCAGCGGAAGACTAAGAAGAATGCTCCTGTCCCGTCCCAGCCTGCGAAGGCGGGGCCCGGCAGGAGCCGAAATAAGAAGAAGGGGGGCGTCAACGCCGCCAATCCGGCCCCGACCCCCCAGCCCCGCCCACTGCCCCCTGCCCCGGCCAATATGGAAGAGGCCTGGACGACGGTAGTGCGGCGTGGGCCTAGGAAAGTGGCGGCGCCTGCTGCGCCGCGTCCCAAGCCCGCCCCTGCGGCCACCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCAAAAAGGAAGGAGAGGAGCACGCAGAAAGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTATTGGAGCTGCTGCCGGCCGCCAAAGAAAAGGGCATCACATACCACGACGTGATGACCCAGGCGCGCGGCGGCGTAAATGTGGACGCCCTCGGCGTGGAGGGTGGCGTCAAGGTCCGGCAGACGGCCAACGGGGCTCGTCTTTTGGAGTGCCCCGGCGAAAACACGAACGCCGCGGCCGAAAAACTGGCGGCCCGGCTTCGAGAAATTCTGCCGGACCCCGAGATGGTGCGCATCGCGCGGCCCGTGAAGATGGGAGAAGTTAAAATCACGGGCCTCGACGAGTGTGCCACGAAGGAGGAGGTCGCCTCGGCCATCGCGTCGCAGGGCAACTGCGCTCTCGCCGACGTCAAAGTCGGGGAGCTCCGGGTAACCTACTCTGGTACCCGGACGGCGTGGGCGCGTTGCCCGATTGCAACGGCGACCCTCCTGGCCACCCCTCCACAGGGGCGGCCTTCCGACAGCCCAGGAAGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAGCTGCAGGATGCCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGGCTTGTGTTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAATCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGGGCAGCCGGTGAGTCAGCTCCCGCCGCGGCACCAGAGCAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGATGTTGCTGTCGCCGCGGAGCCGTATTTCGTCCCCACCGACCAGGACTGCTGGAACGGGGACGTCGACGGCTCCGTGGCCATTATATTACGACAGTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAACAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTGCACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCACGGATGCGAGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGCAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGAACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATATGTCCGATTTGAGCTCTCCGCCTCCTCTGCGTCCTCAACGTCGTCGACATTGTCTTCGGCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCACCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAATAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCACCAAAACCCGCGCAGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAATATTTGTGATGCCGCCATGCCCCGGGTCGGCCCTCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCAAGACTCCGCGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGCCGCCGCCGTCGTCGCGACGCTGCGTTTGCGGAGACGGCGGCCCAGCTGCACGCTGAGTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATTGTTGCGGCACTCTTCCCGCCGGCAGCAGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAGGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCAGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAATGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTGAGCGTCATTTGCTACGCTGACGACACTCTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTATTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTATCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCAGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACCTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCTGACCGCGACGAGGATGACACAGCGGATCACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGTGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGGCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCCTAATCACCAGGACCGAGTCATGAGACTGGGTCCTAATGACAACACTATTCGTTAA
Protein
MALAEGPAAAAAPPATDFEKPSSCGLDAASSAQFKAACREAKNKNRKIEEVERLQRSLTEVGPSDPLRACKIVGKIVATIAAKSTGGLKGTEVSAMKSAAATLEERLQDVVDRTTTTETAGLRQEIALQHARLEQLAEENGRLRAENGQFRVDMAELRTMVADLIERQRSSAPVLPPPEAEGLTEVEELRRQLLIQEARSSRVERARPPLAHEAKGSAPVPAPRKTVAVRTYGGPAKGATPAARPVASAAVPAKPGPTDPRNQQNTGAPKPAPSGAPVTGQRKTKKNAPVPSQPAKAGPGRSRNKKKGGVNAANPAPTPQPRPLPPAPANMEEAWTTVVRRGPRKVAAPAAPRPKPAPAATAPRQEGRAEPRGQKGRRGARRKPRAPRSAAVVLELLPAAKEKGITYHDVMTQARGGVNVDALGVEGGVKVRQTANGARLLECPGENTNAAAEKLAARLREILPDPEMVRIARPVKMGEVKITGLDECATKEEVASAIASQGNCALADVKVGELRVTYSGTRTAWARCPIATATLLATPPQGRPSDSPGRLRVGWVVAHVQLQDARPWRCLRCFGTGHGLAKCPSTVDRSGLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAAKRAAGESAPAAAPEQPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWNGDVDGSVAIILRQSAALPPLDMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGQSHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSASSTSSTLSSASAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPAQLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRRDAAFAETAAQLHAECRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVAALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPSEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEDDTADHTLARCSGFDEQRAALVAVIGEDLSLPCVVATMLGSDASWKAMLDFCEATISQKEAAERERESSSLSAPIRRRRAGGRRREYAPNHQDRVMRLGPNDNTIR

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=7.11165e-10,     Score=159

Ontologies

Topology

Length:
1737
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18753
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1737
 
 

Population Genetic Test Statistics

Pi
107.998183
Theta
10.49745
Tajima's D
0
CLR
0.853304
CSRT
0.379831008449578
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号