SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10978
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.386 Nuclear   Reliability : 1.055 PlasmaMembrane   Reliability : 1.07
 

Sequence

CDS
ATGCTCACGAATCAATATACTCGTAGAGAATATCATAACAAAAGAATCAGATATAAATTCGTAATTACGCAACGCTATCCTGATCACACAGGAGCCAGTCACCGTCTACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGACGCCTTCAGCTCTAACACTAGAAGTGGCCTGGACGACTGCACCACCAGGGATGAGGTGACGGCGGCCGTCGCTGCCCAGGGCAAATGCGCACTGGAAAATGTTACAGTAGGCGAGCCGCGCCGCGGTTATACCGGGGCCAGCTCGGTATGGGTGCGTTGCCCGGTGGAAGCGGCCGCCTCCCTGGCTGCTCCTCCTCCCGGGAGACCTTCGGGAAATCCGGGCATGCTGCGCGTGGGCTGGATAGCGGCCCACGTGCACTTGCTTGAACCACGCGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGACACGGCCTCGCCAGGTGCACCAGCTCGGTTGACCGCAGTGGTCTGTGTTTCCGCTGCGGCCAGCCGGGACATAAAGCGGCGTCCTGCACGGCTGCCCCGCATTGCGCTCTGTGTGCTGCGGCCGGGCGCAGGGCAAGCCACCGAACGGGAGGCAAGGCGTGCTTTTCGTCCGGTAATAATACCGAACGCAACCGGCGCCGCAAGTCAAAGCGTCGGCAAAACAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGTGCCGGTGCCGGAGGGCGGGGGCAGTGGTGAAGGGGAGGGGGCGATGGATGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTTGGGGACGATGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGTTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCAAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGTTCCCCCCGCTCGGACGCTCGTGGTAGGCTGCTGGAGAGGTGGGCGAACGTGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTCTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACAGGGACCACCCCCATGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTATGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCAGGGTGGTTCCGGGACACGATGTGTCGCATTTGTGATGCGTCGATGCCCCGGATTGGCCCTCGACTTCCTAATCGCCAAGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGACGCAATGATCCGGTTGCATTCGCGGCGGAAGAGGTCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGATGGATTTATCGCTCCCGCTATGGACACGCCGCCGGAATACGACGGTGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTACGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGTCGGGTTTGGGGCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACCGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGTATTCTGGCAGCCCGCATCATCCAGCATCTGGCCGGGGTGGGACCCGATCTGTCGGCGGAACAGTATGGCTTCCGAGAGGGCCGCTCAACCGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGCGGGGTGGCCCTGGCGGTATCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGCGCTGGAAAGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGCCCCGGAGAGTGCCACCTATCGATGCTCAAATCGTGGTTGGAGGCGTCCGTATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGGTCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCAAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACTTTCGTGCCCGGGGCGTGGCGCGCCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAATCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCAGTCCTTGTGGACTGGGCGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MLTNQYTRREYHNKRIRYKFVITQRYPDHTGASHRLRPRHVLTDPSDPITFALDAFSSNTRSGLDDCTTRDEVTAAVAAQGKCALENVTVGEPRRGYTGASSVWVRCPVEAAASLAAPPPGRPSGNPGMLRVGWIAAHVHLLEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRASHRTGGKACFSSGNNTERNRRRKSKRRQNRRLARGALANAVIPAAVPVPEGGGSGEGEGAMDDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANVAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHRDHPHGASRSFPKWALKRLNKELLMEASMVAAWAPMRPHPVEVEGEAGWFRDTMCRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAEEVRLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQERDGFIAPAMDTPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWGLALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLAGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGRWKDTECPPTFAGWPRRVPPIDAQIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADFRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWANRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=5.39705e-11,     Score=167

Ontologies

Topology

Length:
1194
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.677399999999997
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02740
outside
1  -  1194
 
 

Population Genetic Test Statistics

Pi
132.672335
Theta
24.67782
Tajima's D
0.67003
CLR
0.213053
CSRT
0.574121293935303
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号