SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10963
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.416
 

Sequence

CDS
ATGGGTGCACGCCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTATCAGAACAGTTACTTATGAAAACAACTGCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGTATACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACACCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAGTCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAATACAAATCTCGAGCGCCGACTATTAGAATTTCTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGAAGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGGTTAATGCAGTATTTACAAGTAAAAGAAAATATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGAAAACATAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACACGCTGATCACATCAGGCCACGCGAGTCTTCCACCTCAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGCCGACGACTGCTTCTCCAGACATTGGAATGGAAACATCAATTAGCGAAAGGCTAACTAACAATAAGAATTCATTACCTACACTGCAGTCGCCTACAAATGTACAAATTTCTCCAAATTCACCTTCACAGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTCCGCGTCGAAGTAATCGACGTATACAGGCACCCCGCCGTCTGATCAACGAGATGTAG
Protein
MGARRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTAKDHILTKVCQNLKTGWRESVYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAVITSRKHKYSYIVSTPGGLEKRRHADHIRPRESSTSETPRNERAHSSMLPTTASPDIGMETSISERLTNNKNSLPTLQSPTNVQISPNSPSQHSKLYSSPAPVSTPVPFAPRRSNRRIQAPRRLINEM

Summary

EMBL
GDHC01014693    GDHC01004534    JAQ03936.1    JAQ14095.1    GBHO01042589    JAG01015.1    + More
GBHO01042596    JAG01008.1    KL363205    KFD54654.1    KL367712    KFD59941.1    KL367659    KFD60588.1    GFTR01008725    JAW07701.1    KL363234    KFD51952.1    JWZT01000439    KII74358.1    GBHO01042594    GBHO01042593    JAG01010.1    JAG01011.1    JWZT01002984    KII68048.1    GBHO01045651    GBHO01045644    GBHO01026684    GBHO01026679    JAF97952.1    JAF97959.1    JAG16920.1    JAG16925.1    JYDL01000067    KRX18868.1    EF199622    ABM90393.1    JYDO01000448    KRZ65220.1    EF199621    ABM90392.1    AERX01052799    AERX01052800    GEGO01004800    JAR90604.1    JYDL01000080    KRX17894.1    JYDO01000377    KRZ65389.1    JYDJ01000966    KRX32990.1    KL363182    KL367475    KFD58860.1    KFD72876.1    JYDK01000060    KRX78865.1    JWZT01005674    KII60352.1    JYDJ01000471    KRX35129.1    GEFM01002211    JAP73585.1    JYDN01000036    KRX62859.1    GEFM01006397    JAP69399.1    JYDW01000348    KRZ48953.1    JYDN01000181    KRX54093.1    HAEH01001481    SBR66981.1    JYDH01000010    KRY40903.1    MRZV01000113    PIK58451.1    JWZT01001719    KII71554.1    GBIH01000761    JAC93949.1    JYDO01000093    KRZ71620.1    NIVC01001652    PAA65446.1    KRX54086.1    GFAA01002662    JAU00773.1    HADW01008367    SBP09767.1    HADX01010638    SBP32870.1    JYDQ01000025    KRY20467.1    AZHX01001899    ETW98900.1    MRZV01000478    PIK49152.1    KL367976    KFD59423.1    JYDP01000327    KRZ01162.1    GEBQ01020673    GEBQ01011946    JAT19304.1    JAT28031.1    JYDI01000050    KRY55859.1    MRZV01000143    PIK57404.1    KRX62850.1    KL363365    KFD46539.1    GFAC01001150    JAT98038.1    HAAD01006009    CDG72241.1    JYDH01000054    KRY35448.1    KRY35447.1    JYDL01000001    KRX27995.1    JYDI01000010    KRY59721.1    GEGO01004546    JAR90858.1    JYDI01000800    KRY43965.1    JYDI01000169    KRY49681.1    KRY35446.1    NIVC01000050    PAA92506.1    AY816119    AAW27851.1    GEGO01004367    JAR91037.1    KL367587    KFD62819.1    JYDH01000411    KRY26494.1    MRZV01000184    PIK56202.1    GEGO01004533    JAR90871.1   
Pfam
PF00665   rve        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF00098   zf-CCHC
PF04500   FLYWCH
PF00077   RVP
Interpro
IPR000477   RT_dom        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR034128   K02A2.6-like       
IPR041373   RT_RNaseH       
IPR007588   Znf_FLYWCH       
IPR018061   Retropepsins       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
3S3N     E-value=4.20849e-17,     Score=217

Ontologies

Topology

Length:
532
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0381800000000001
Exp number, first 60 AAs:
0.03108
Total prob of N-in:
0.00393
outside
1  -  532
 
 

Population Genetic Test Statistics

Pi
246.375712
Theta
181.41516
Tajima's D
0.66419
CLR
41.934557
CSRT
0.559322033898305
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号