SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10957
Annotation
PREDICTED:_vam6/Vps39-like_protein_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.795
 

Sequence

CDS
ATGGAGCGTAAATCAGTAAAATTCCAAGAATTTAATGTAAAATCGGATAATTGGGACAGTTATATTGACAGACTAAAATATTGTTTTGAGGCAAATGGAATCGAAAGTGATACTGTTAAAAAGGCTAATTTCTTTACTGTGTGTGGTGCTGAAGTGGTCGAAACTGTTCTCGCGTTAATTACACCAAGAAAATCTAGTGATGTGACTTTTGTTGAAATTGAAAACATTCTAACCAAACATTACAGTCCGAAACCAAATGAAATTTCTATGTCATACAAATTCTACAAACGAGATCAGGCACCAAACGAATTGGCTTCTGATTATATTGCTACGTTACGCAAAATTAGTTCGGGATGCAATTTTATTGAATTAGAACGTATGCTTCGAGATAGACTGGTGTGCGGCATGAGCGATCATAAGCTTCAGTATGAGTTGTTGAAGAGAGAACAACTTCGTTATGAAGATGTTGTACATGCTATGGTATCATCGGAGAGCGCCGGAAAGGATGTGCGCATGATTCAAAGCACGAGCACGGACACATTTGGTATGACACAGGGTGAGGTAGTGACGTCACATGCCGAGCCTATGGAATGTAAGAAAAAAGGGCATATTGAAAAGATATGTACATCTAAGAAAAACAACAAAAGAAAGAGCATTAACTATACAGATGATGAATTTCAAGCGCAATTAAATGGTATTTACAACGTGAACACAAATAGTCGGCGCGTACCAGCTTACGAAGTAAATGTGTTACTAGATGGTGTACCAGTGATTATGGAAGTGGACTCGGGTGCTGCCTACTCTCTTGTGAATTTACATACGTGGCGTCGAATACACTCTCACATGCCTTTGGAACCTTTGATGAATAAATTATGTACTTGGAATAATTCTGCAGTCAGAGTGGACGGTCAAGCCACAGTGCTAGTACAATATAAAGACATTAAATGTTCTCTTAAGGTTATTGTGGCTCAGGGTTCGGGTCCAAATTTGTTAGGACGTAATTGGTTTGAAGCTTTAGGAATATGTGTAAATGTAAATACTATTAAAGAAATTAATGTGACTGAGGTAATTTTGAATAAACATTATGAAGTTTTCAGAGCCGGACTCGGTACTTATCGTGGGGAACCTGTAAATATTCACCTGAAACCAGGTGCAGTGCCAAGATTTATGAAAGCGCGTCCTGTACCGTACGCTATCAAAGAAAGAGTTGAAAAAGAAATCAATCGCCTGGAAGCTGAAGGAGTACTCCGCCCTGTAACTTTTTCTGAGTGGGCTACTCCAGTTGTTCCTATCGTAAAAAAGAATGGAGACGTACGCCTTTGTGGAGATTATCGTAGTACAGTTAATCAGGCTACAGAGTCTGATACGTATCCAATGCCCACCGCAAGTGAAGTGTTTGCCACCATCTCTGGAGGTAATATTTTCTCAACGTTAGATCTTGATCGTGCTTATACTCAGGTGGTTGTCACAGACGACACAGCACGTCTCCTAACCTTAAACACATGTAAAGGTCTTTACACGGTACATCGGCTAGCTTTCGGCGTCAAGGCTTCCCCGGGTATATTCCAACGTTTAATGACAGCATTACTAGCTGGCATATCTGGTGTTGCAGTGCTAATCGATGACATCATCGTTAGTGGTAGAACAGCGCAGGAGATGACACAACGCTTAGATGCAGTCCTGGATCGCATTGAAAAAGCGGGATTACGACTCAATAAAGGCAAATGTAAGTTTGTAAGGAAACAAGTAGAATTTTTAGGTTTCATAATTGATGCTGAGGGTATACACCCTGCACCGAGTAAAGTAGAATCAATATTGAAAACTCCCAAACCTAAGAACGTACAAGAGCTTCAAGCTTTTCTTGGCCTTTATAATTTTTATGAGAGATTTATTCCTCACAAAGCCACCATACTTGAACCTTTACATAGATTGCTAGACAAAGCACATAAGTGGCAGTGGTCAGAACGGGAACAGAAAAGTTTCGAGGTAGCAAAACGTTTGTTGTCCTCAGAGTTAACCTTAGCTCATTATGATCTTGAAAAACCTTTGATACTTACCTGTGATAGTTCAGATTACGGTGTAGGTGCAGTTTTGTCACATGTCATGAGTGACCGACAGGAACGACCTGTTGCTATGGGGTCCAGGACACTTCACATGCACGAACGGCGCTATTCGCAGCTAGATAAAGAAGCGACTGCAATAATGTTTGGAATAAATAAATTTCAGAACTATCTCATGGGACGGTCATTTACTATTGTCACGGATCACAAACCTTTGTTAGGTATATTTGATCCAAGAAAGCCCATTCCTAATATGTTGTCACCACGTCTTACAAGAATAGCATTAGTACTTACTTCACATAATTATGATATTATTTATAAACCGGGAAAATGCATAGGACATGCAGATGGGTTGAGTCGTTGGCCACAACCTGTATCAGAACAACCTGAAGAACAGCTTCAGGACATATTGCTACTGGCCGAAACACCAGACGAGTTTCCAATAGATGTTGCTCAAATAGCAAATGCTACCAAACGAGACTCAGTTTTGTCTCGAGTACGGCATCATATACTTTCCGGATGGCCAGCTAAGATAAATGATGAGTCGCTACGTCCATACTGGCTTCACCGAAATGAATTTTCCTTGAATGAAGACTGCATTCTAATAGGCAATCGTGTAATAATACCACCATCGCTTCGGCAGCCAGTTTTAGATTGTTTGCATAAAACTCATAGTGGCATCGTTCAAACTAAAGCGATTGCTCGTAGCTACGTCTGGTGGCCACAAATGAATAAGGATATTGAAAAGTTGGTAAAGAACTGTAATCGCTGTTTGGAAAATCGACATATGCCCCCTAGAACAACTTATGAATGGATAACTCCTACCAAACCTTGGTCTCGTATTAATGTAGATTTTGCGGGACCATTCCAAAATAAAATATTCCTGATTATAGTTGACGCGTATTCGCGATGGCCAGAAGTATTCATTGTTAACAATATGACTTCGTCGACCGTTGTTAAACACCTTCGAACAATATTTGCGACACACGGATTGTGTGAGGTATTGGTGTCTGACAATGGAACACCTTTTGTATCTGAAGAAACAAGAAAATTTCTAGAGTCTAACAAAATTAGACATATTACAACGGCGCCACATCATCCGTCTACTAACGGACTGGCAGAAAGAATGGTTCAAACAGTCAAGGACAAGTTACGGAAGATGGACGGTATCTCTTGGGATATAAAACTTCCCAATATATTATTAGGACTTCGCACAATTCCATGTGCAACAACAAATAAAAGTCCATGTGAATTATTGATGAACAGGCGTTTGCGCACCTTGCTTGATACACTCCATCCAGACAATCTCCAAACGTGTAAGAGAAATGAACAGATTGAAAGAAATGGCAACAAAAAAATTAGACACACTGATGTGGGGCAGAAAGTGATGTACAGGAACTTTGGAAATGGATCCCGTTGGTTACCAGGAACGGTAGTTTACAGGAATGGGCCAGGAAACTATCAAGTAGAAACTGGTGATGGAACAGTGGTGAATAGACATATAGATCAATTACTTAAAAAAGAAACAGATTCTGGACAGGAAACTGCAGAAAGAGGGAAGGAATCGGAAGTGGATTGTGAGGCAGTGAATGTTGAGGAACAAGAAGATATGGAAGACATTTCTAGTAGTTTGGAGGAACAGGAAATTATAGAGATACCGAGTCCGGATAAATGGGCAGAAATGTTAGGAATTCCTCCCGAACCAGAATCAGGATATTCTGGTGAGAATAACCTATTATTAGGTACGAGGCAAGGCCATTTATTGATGTACTCTTTATCAACAAATAATGAAGAGCAAAAGTATCAGGTACATTTGTTAAGATACAGGAAGAATTTTAGCAAAAAACCTATTCAGCAAATTGAAGTTATACTGGATGAAAATCTATTATTATGTCTGACAGATTCTACACTAGCTACATACAACATTAATGGTGTTAATTTTCCATTAATAAAAACTTTTGAACAGACAAAGGGTGCTTCACTTTTTGCTTTGGATTGTAAGGTTTCATCAAGTAATGGTGCAGCGTCATCTGATGTTCGTCTTTGCGTTGCAGTAAGGAGGAAACTTCAAGTGTACTGCGGGAGTAAGGGTGAATTTAAACACATGCTAGATCTAAATATACCAGATGTACCAAAAGTAATGGCCTGGGGTCTGCAGTATCTATGTGTGGGATTTAAAGCAGAGTACACCCTATATGATGTGTCAGATGGAAAACCAAAAGAACTATTTCCCACAAGTAGTTCTAAATCATTAGAGCCAACTATTTCTAAGTACACAGAGACATCTTTCCTAGTAGGACGTGACCAAACATCGGTTCTTATAGAGGAGTCTAATAAAAATGTCGATATAAAGAAAACTATTAAATGGAAGGAGGCGCCTCTTGCTGTGGTGTGGGATCAGCCGTTTGTACTGGGTCTATTGCAAGATCAAGTTGTTGTGCAGACTGTGGAGCCAGCGTTTTATATACAATCATTGTCCGAATTGAATAAAGCAAGACTGATGTACAGATGCAAACGAGGCTTAATATTCGTGGCCTCCGTCGGGCAGGTGTGGTGTCTCAGCTTAGTCGACATAACGAAACAAAGGCAACAGCTACTGAAAGACAAACAGTTCCAAATAGCTATAGAGTTAACTACGTTGTCACAATGCTCGCCCGAGGAGAAAAAACAAAAAATACATTCCATACAAGTGCTGAATGCACTAGAAGACTTCGACAACAAATGTTACACGCAAGCGATGCAGGAATTCGCCAAACTAAACACCGATCCGGCCGATGTCATCAAATTGTTTCCTGAACTAGACGGCCGTACAGACGGCGAGAAAAGTGGAAAGCTGAAAGGGAAAGATTTAGAGAACGCTCTGAACGCACTTATACCGTATTTAGTTGAGTTGCGAAGAAAGATCGGCAAGGGCAGTCCCGAACCTAACGGGTCTCCTCCGCAAGAGGGAACCAGCCAAAGAAACGTCGCTCAGCAGATGGAGTTGATTGATACAACGCTTCTGAAATGCTATTTAATGACAAACGACGCATTTGTCGCGCCCCTGTTACGCTTGAACAATTGTCGTTTAGAGGAGGCCGAGAAGACATTACTGCAACACGGCAAGCACAGCGAACTGATAATATTGTACCAAACTAAAGGGCAGCACACGAAGGCGCTTCAGCTGTTGCGGGAACAAGCCAAGCAGCCGGACTCCAGCCTCGAGGGATATCGGGGCACTAAGAACTACTTGCAACAGTTAGGTGCCGAGCATATAAATTTAATATTCAATTTTTCCGATTGGATTCTGAAAGAGAACCCCGAGGAGGGCTTGAAGATATTCACGGAAGATAAAATCGAAGTCGAAAACTTACCCCGTCCGAAAGTACTTGACTTCTTACTGAGAGAACACGAATCGCTTGTGATACCTTACCTGGAACACATTATACACACGTGGAACGATACGAATCCATTGTTCCACGACGCCCTAATAAACATGTACAGGGAGAAGATAATTAATAAAAAAGCGAATATTACCGAAGAAGAATTGCTGCATACGAAGTCGAAGCTGTTGGCTTTTCTAGAAAAATCGACTCACTACACGCCCGAGAGAGTGTTGCTGCATTTCCCTACCGATGGATTGTTTGAGGAGCGCGCCGTGGTGCTGGGGAAGCTGGGACGACACGAAATGGCGCTCGCAATATATGTGCTGATCTTGGGGGACGTGGAAAGAGCGATGCGATACTGTGAAAACGTGAGTGAAAATCTCAAGGACAAGAGTCAAGACGTTTACGTTATCCTCATGAAGATATTGATGAATCCCGATCAGATTGCCGCCCTTAGCGGACCGCTCGCCAACGTACCAAGACACCCGAAAACATCGGTGCCCGATCTAGAAACGGCTCTGGATATATTGGAAAAACACGCTGATAAGATCTCTCCCTTAAAAGCACTCGCAGTATTACCAGATTCGGTGCCGCTTAGCCGATTGAAACACTTTCTGGAAAGCTCATTAGAGGCTCAACTCACGTTGAAACGGAGAATGCAAATACTCAAAGGACTGTTGTATGCGGAACATATGCAGGTCCAAGAGCTGAAGCATTACCACGAATCAAAGAGTGTTGTTATAAACGACTACGACGTGTGTCAAGTTTGCAAGAAGCGCTTCGGTCATCAGAGCGCGTTCGTGCGTTATCCAAACGGTGACATTGTTCATTATTCGTGTAGAAGCGATAAATAG
Protein
MERKSVKFQEFNVKSDNWDSYIDRLKYCFEANGIESDTVKKANFFTVCGAEVVETVLALITPRKSSDVTFVEIENILTKHYSPKPNEISMSYKFYKRDQAPNELASDYIATLRKISSGCNFIELERMLRDRLVCGMSDHKLQYELLKREQLRYEDVVHAMVSSESAGKDVRMIQSTSTDTFGMTQGEVVTSHAEPMECKKKGHIEKICTSKKNNKRKSINYTDDEFQAQLNGIYNVNTNSRRVPAYEVNVLLDGVPVIMEVDSGAAYSLVNLHTWRRIHSHMPLEPLMNKLCTWNNSAVRVDGQATVLVQYKDIKCSLKVIVAQGSGPNLLGRNWFEALGICVNVNTIKEINVTEVILNKHYEVFRAGLGTYRGEPVNIHLKPGAVPRFMKARPVPYAIKERVEKEINRLEAEGVLRPVTFSEWATPVVPIVKKNGDVRLCGDYRSTVNQATESDTYPMPTASEVFATISGGNIFSTLDLDRAYTQVVVTDDTARLLTLNTCKGLYTVHRLAFGVKASPGIFQRLMTALLAGISGVAVLIDDIIVSGRTAQEMTQRLDAVLDRIEKAGLRLNKGKCKFVRKQVEFLGFIIDAEGIHPAPSKVESILKTPKPKNVQELQAFLGLYNFYERFIPHKATILEPLHRLLDKAHKWQWSEREQKSFEVAKRLLSSELTLAHYDLEKPLILTCDSSDYGVGAVLSHVMSDRQERPVAMGSRTLHMHERRYSQLDKEATAIMFGINKFQNYLMGRSFTIVTDHKPLLGIFDPRKPIPNMLSPRLTRIALVLTSHNYDIIYKPGKCIGHADGLSRWPQPVSEQPEEQLQDILLLAETPDEFPIDVAQIANATKRDSVLSRVRHHILSGWPAKINDESLRPYWLHRNEFSLNEDCILIGNRVIIPPSLRQPVLDCLHKTHSGIVQTKAIARSYVWWPQMNKDIEKLVKNCNRCLENRHMPPRTTYEWITPTKPWSRINVDFAGPFQNKIFLIIVDAYSRWPEVFIVNNMTSSTVVKHLRTIFATHGLCEVLVSDNGTPFVSEETRKFLESNKIRHITTAPHHPSTNGLAERMVQTVKDKLRKMDGISWDIKLPNILLGLRTIPCATTNKSPCELLMNRRLRTLLDTLHPDNLQTCKRNEQIERNGNKKIRHTDVGQKVMYRNFGNGSRWLPGTVVYRNGPGNYQVETGDGTVVNRHIDQLLKKETDSGQETAERGKESEVDCEAVNVEEQEDMEDISSSLEEQEIIEIPSPDKWAEMLGIPPEPESGYSGENNLLLGTRQGHLLMYSLSTNNEEQKYQVHLLRYRKNFSKKPIQQIEVILDENLLLCLTDSTLATYNINGVNFPLIKTFEQTKGASLFALDCKVSSSNGAASSDVRLCVAVRRKLQVYCGSKGEFKHMLDLNIPDVPKVMAWGLQYLCVGFKAEYTLYDVSDGKPKELFPTSSSKSLEPTISKYTETSFLVGRDQTSVLIEESNKNVDIKKTIKWKEAPLAVVWDQPFVLGLLQDQVVVQTVEPAFYIQSLSELNKARLMYRCKRGLIFVASVGQVWCLSLVDITKQRQQLLKDKQFQIAIELTTLSQCSPEEKKQKIHSIQVLNALEDFDNKCYTQAMQEFAKLNTDPADVIKLFPELDGRTDGEKSGKLKGKDLENALNALIPYLVELRRKIGKGSPEPNGSPPQEGTSQRNVAQQMELIDTTLLKCYLMTNDAFVAPLLRLNNCRLEEAEKTLLQHGKHSELIILYQTKGQHTKALQLLREQAKQPDSSLEGYRGTKNYLQQLGAEHINLIFNFSDWILKENPEEGLKIFTEDKIEVENLPRPKVLDFLLREHESLVIPYLEHIIHTWNDTNPLFHDALINMYREKIINKKANITEEELLHTKSKLLAFLEKSTHYTPERVLLHFPTDGLFEERAVVLGKLGRHEMALAIYVLILGDVERAMRYCENVSENLKDKSQDVYVILMKILMNPDQIAALSGPLANVPRHPKTSVPDLETALDILEKHADKISPLKALAVLPDSVPLSRLKHFLESSLEAQLTLKRRMQILKGLLYAEHMQVQELKHYHESKSVVINDYDVCQVCKKRFGHQSAFVRYPNGDIVHYSCRSDK

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=4.98129e-53,     Score=532

Ontologies

Topology

Length:
2092
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.145470000000001
Exp number, first 60 AAs:
0.08835
Total prob of N-in:
0.00616
outside
1  -  2092
 
 

Population Genetic Test Statistics

Pi
223.607119
Theta
178.497471
Tajima's D
2.014073
CLR
0.364861
CSRT
0.881305934703265
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号