SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10956
Pre Gene Modal
BGIBMGA008502
Annotation
PREDICTED:_uncharacterized_protein_LOC106133664_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.738
 

Sequence

CDS
ATGGAGACGGAAAGACAGAAATTCTACAAACATAAAATCAAACGAATCAGTATTTCGAACAAGGATGATAAGTCTTCCGTAATTGATGAAAGCGACACTAGCAAATCTACAGTAACAATATTAGGAAGTACCTCTTATCATAAACAAGTCAACGATTTAAGTATTATTAATTCCAACAACATAGATCAACAACCTGAAACCTTGTTTGGTGACCGAATCGATTTAAATTATGAATCGAACTTTTATGCCAATACTGTGGATGAGGTGACAAACATGACAGATGAAAATATACCTGATGATTTGAATGACCGTGATGTAAATATTAACGAAGTAACGATTGAAGTGGAACGAGAGTATCAAGAAGAAATAGACAAACCTGAAGTAACGGAAATAGAAAGAACCATTAGTAACGACAGCCTTCAACCAACTATTACCGATATCATACCTGAAAAAGATATGGATATATTGAGAAAATCTTTAGAAGATGATAATTTGGATGACAATGTACAACTAATTCAAACAGCGGATGATAATCCAATACGGAAAAAAAACAAACGGGTTGGAGTGAAAAAAAGCTACGTTGATTTTTTAAGTGAAGATGACGATTTTGCCTGGGACTCAACGTCGTGGAGAGAAACAGACGACTCTTCAAGTGATCAAGATGATCAAGTACCAACGAAGAAAAAGAAAACAAGCATAAAAGATGGAAAAGTGGGAGATGCAGGATTAAAAAAGAAAAGAACAAATAAGAAAAAGGTACGAAAGGATGCTAGATCAAAAGGCGTTCAATATGTTAAGGCAGATGGTTCAATTGTGAAAGAAAGAAATATGAAACCGAATCCTTGCTTAAAAAAAAACTGTCCCTACAAGTGTCAAGAAATAACCTCAGAAAAAAGGAGTGCCATATTTAAACATTTTTGGGAATTATCTCCGGAAAGAAAAAAGCAGTGGATAATATCTATGTCCTCTAAGCAATCCATAAAAAGGAAGAGATCCAAAGACTCTAATTACAGGAATAGCACATTCTGTTATTTCATAAATGATGGAGAGGGTCGGCGACAAGTTTGTTTAAAGTTCCTCATGAATACTCTTGATGTCACTCAAAGATACATTTATTATACATTAACAACACAGGAACTTGGTATGGCGAAAGAAGATGGAAGAGGAAAATGCATTCCCCCCAACAAAACATCTAACGCAATCAAAGAATCAGTAAAATCTTTTATCAAAAGGTTACCTGCAATACCATCGCACTACTGCCGAAAGGATAGCACAAAACTATATCTGCCTGTTGAATTTAAAAATATAAAAAATTTATACCGCTGTTATAAAGAAGACCTCATTAGTAAAGGAGTCGATGTTGTAAGTGAAAAAGTATTCCGTCAAATATTCACTACTGATTTTAACATTGGGTTTCATGTGCCTAAGAAGGATAAATGCATAAAATGCCTACGTTTTGAAGGACAGAAGCCAGAGGATTGTGCCAAATTTCAAGATCATTTAGAGGAAAAGAAGGCATCAAAGAAGCGGTTAGAATGTCATCGACAGTTAGGTAAAGAAAATCCTTCCATTCTGTGCACATCTTTTGACCTCCAGAAAGTTCTCAATACGCCTCATGGCAATAACATGTTACTATTTTATTCTAGAAAGTATGCTGTTTATAATTTATGTTTTTATGAAAGCATCACAAGGAATGGTTTTTGTTTTATCTGGGGAGAATCTGAAGCAAAGAGGGGCGCAAATGAAATTGCTACTATTATACAGAAATACATAGAGAATGTGGATTCTCGAGGTACCATTACATCTTTGATCTTGTATTCAGATTCTTGCCCTGGACAAAACAAAAATAAAATAGTCCTTGCAACAATACATAATGCTTTGTTGCAATCGAACAATTTACAAGCAATTCAAATGAATTACCTTCTCCCTGGCCACACGGAAATGTCGGTAGACAGCATACACTCTACAATCGAACAATCCGTAAGAAATATTACTGTATGGGCCCCTTCGCAATGGGCTACAATAAGCCAGCTAGCAAGAAAAGAACCAGCACCTTATAATGTTGAAAATCTGACACACGAGGATTTCTTAAATTTTGATGATATGTCTGAAAAATATTTTAAGGGTAACCTTGTAGGTAAAATTAGTAAAATCCGTACAGCAACATTTAAAAAATCTCATCCAAATCAAATGAAAGTAAAATTTTCAATGAAAGATAATGCATCCGAAGAGATTATACAAATTATTGCGAAACCTAGAGCTATCAATCGTAGATATAATACAAGTTTGCCGATTACCAAAGCCAAATACATGGACCTAAAGAAATTGTGTGACACTGGGGTTATACCCAAGATATTTCATAAAGAATACATAAATCTACAACACTGCAATTCCAAAGATGTTCTACTGGATACTGATGTAGAAGATACAGTCGAAGAAAATGATTATTAA
Protein
METERQKFYKHKIKRISISNKDDKSSVIDESDTSKSTVTILGSTSYHKQVNDLSIINSNNIDQQPETLFGDRIDLNYESNFYANTVDEVTNMTDENIPDDLNDRDVNINEVTIEVEREYQEEIDKPEVTEIERTISNDSLQPTITDIIPEKDMDILRKSLEDDNLDDNVQLIQTADDNPIRKKNKRVGVKKSYVDFLSEDDDFAWDSTSWRETDDSSSDQDDQVPTKKKKTSIKDGKVGDAGLKKKRTNKKKVRKDARSKGVQYVKADGSIVKERNMKPNPCLKKNCPYKCQEITSEKRSAIFKHFWELSPERKKQWIISMSSKQSIKRKRSKDSNYRNSTFCYFINDGEGRRQVCLKFLMNTLDVTQRYIYYTLTTQELGMAKEDGRGKCIPPNKTSNAIKESVKSFIKRLPAIPSHYCRKDSTKLYLPVEFKNIKNLYRCYKEDLISKGVDVVSEKVFRQIFTTDFNIGFHVPKKDKCIKCLRFEGQKPEDCAKFQDHLEEKKASKKRLECHRQLGKENPSILCTSFDLQKVLNTPHGNNMLLFYSRKYAVYNLCFYESITRNGFCFIWGESEAKRGANEIATIIQKYIENVDSRGTITSLILYSDSCPGQNKNKIVLATIHNALLQSNNLQAIQMNYLLPGHTEMSVDSIHSTIEQSVRNITVWAPSQWATISQLARKEPAPYNVENLTHEDFLNFDDMSEKYFKGNLVGKISKIRTATFKKSHPNQMKVKFSMKDNASEEIIQIIAKPRAINRRYNTSLPITKAKYMDLKKLCDTGVIPKIFHKEYINLQHCNSKDVLLDTDVEDTVEENDY

Summary

Pfam
PF13359   DDE_Tnp_4        + More
PF16064   DUF4806
Interpro
IPR027806   HARBI1_dom        + More
IPR032071   DUF4806       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF53098   SSF53098       

Ontologies

GO

Topology

Length:
816
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00145
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00022
outside
1  -  816
 
 

Population Genetic Test Statistics

Pi
276.385413
Theta
199.777945
Tajima's D
2.388378
CLR
0.163048
CSRT
0.935003249837508
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号