SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10955
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.145
 

Sequence

CDS
ATGGAAGAAAGTGCAAGTGTTTGTGACAGTGATCTTGTCGGGTTCCTCCGGGATAGGTACCCGACAATTAGGGCCGAATATTTAGCATTTAGGGCCTCTCGTGGCAATCCCTCCCCCCCCGCGTCCGTCGCCGCGTATTTCAACCGTGCCTCGGAGGCACGCCGCGCGCCCCCCGCCGCGTTAAGTTCGAGCGCACGTTCCGACGATGCGACTCACGAAGCGCCTAGCGCTACCCCCACCCCCGCGCCCGCGTCGATTACGTCATCGCTCGTATCGTCCGTCGCGACCTCCGTAGTCTCAAGTTCAGGCTCCGATACGGAATCGGAGATGGACTTTGAATCCGCGTCCAGCCCTCAGCCCGGAACCTCGGATGGTTTCCAAACAGTGACACGTGGAAAGAAGCGTACTCGCGCCGTGGAGTCCCGGAACTCCACGACAAAACAGACGAAATCCGCGTCCGCCTCTCGACCGAAAGTAGTAGTTACACCGGAGTCGGACTCCGCGCGCCGCGTAACCCCACCGCCGCGTCCCAAGCCCGCGCCCGCTCCCAAAGTAGCTGCCCCGCCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTGTCCCAGGCCCTTCAGGCAAATAAAATTAACTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATCAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCCTACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTCCCTAAGGAGCTAGAGATAGACTACATTAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCGATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCTACGTTAGATTGCGTTAGAGATAGGGAAACCGCGACCGAACCTCCCAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCCAGGGCTCCGCGAAAACGCCCAACCCACCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCTTCAGTGCCGAAACCTGCCTTCGTGCCGGCTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGCAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGACAACCCCCGAACAGCGGCTCGCGGCCGCGTTCGATCACATGGACGTTTACGAGTCCGTGTCGCCATTCTATAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTTGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAACTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTACAGACGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCTGTCATCCTGGCAGGCGATCTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTCAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTACGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCGCTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGAGAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGTCTCCTTAGAAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGAAGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTATACAACATGGGGGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCCTGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAGCATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATTCCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGCCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTTTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTCTACAATAAGATCGGGACCAAGCCCGAGCTGAGGGGGTTTCCCTGA
Protein
MEESASVCDSDLVGFLRDRYPTIRAEYLAFRASRGNPSPPASVAAYFNRASEARRAPPAALSSSARSDDATHEAPSATPTPAPASITSSLVSSVATSVVSSSGSDTESEMDFESASSPQPGTSDGFQTVTRGKKRTRAVESRNSTTKQTKSASASRPKVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELEIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCVRDRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSTTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITADEVRDAIHNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPRNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIEEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATLGQWFRKWRIDINPTKSAAVLFKRGRPPSITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVYNKIGTKPELRGFP

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00345341,     Score=101

Ontologies

Topology

Length:
1413
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.222510000000001
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00002
outside
1  -  1413
 
 

Population Genetic Test Statistics

Pi
101.302435
Theta
103.146759
Tajima's D
0
CLR
108.902032
CSRT
0.371231438428079
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号