SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10944
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.055 Nuclear   Reliability : 1.635
 

Sequence

CDS
ATGAAGACGACAAAAAAAAAGAAAAGGGTTTCACAGGCGGTCCCCCATTCCACATTTAATGTGGATTTCAGCAATGTCAGGGGCCTACATAGCAACCTTGACGCCGTACACCACCACCTTGAGACGGCGCAGCCTGCCCTGCTTTTTTTAACGGAGACGCAGATATCTGCTCCGGATGATACCTCATACCTTGAATACCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTGTGCGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTTCGGGGCCTCGAACAACGGGACCTGTCCCTCTTGTGGCTGCGCGTAGATCACGGGGGCCGTAGCCGAATCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTGTTTGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTAGTGGTTCTTGGAGACTTTAATGCTCACCACCAAGAGTGGTTGGGATCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATCGAGGGGCACGAGCCTTCTTTGTTGGACCTTCTGCTGACCACAGATCCGGCCGGATACAGTGTGGTGGTCGACGCTCCGCTTGGATCGTCTGATCACTGCCTTATTCGTGCTGCCGTACCACTCTCTCGTCCTGATCGTCGAACGACGACCAGGTATCGAAGAGTTTGGCGGTATATGTCAGCAGACTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCGGGATCCTAACATCTCAGGGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTAATTGCCAAGGCGAAGTCGGAGCACGTCGCTAGAGTTGGCGAGCGATTGAAGAGCTATCCCTCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTCTGCAGGTCTAGTCTCCCACCACTGCGCAAGTCCGATGACAATCTGGCCCACAGCGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCCCCGGTGTGATAGCTCCCTGCCGGAAATCTGCTTCACACAGTGTGCAGTCAGGCGGGAGCTCAGACTCCTGGACGTCCATAAGTCGAGTGGGCCAGACGGCATCCCCGCAGTGGTTTTGAAAACGTGCGCCCCTGAGCTGACACCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCACTAACAGGGTTCCGTCTTCATGGAAGACCGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTACAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATTATAAATACACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCAGATGATAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATCGAACTTAGTTCAATTCAACCCGTTGAAGACACAGGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAGCATCTCAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGA
Protein
MKTTKKKKRVSQAVPHSTFNVDFSNVRGLHSNLDAVHHHLETAQPALLFLTETQISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRGLEQRDLSLLWLRVDHGGRSRIYACLYRSHSSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGFSQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAAVPLSRPDRRTTTRYRRVWRYMSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRRDPNISGERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDNLAHSAKEKADLLVKLFASNSTVDDGGATPPNIPRCDSSLPEICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCTNRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINTQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSKWGESNLVQFNPLKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASQIFFATYHPAME

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00002   7tm_2
PF04939   RRS1
PF01585   G-patch
PF02460   Patched
PF00096   zf-C2H2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000832   GPCR_2_secretin-like       
IPR017981   GPCR_2-like       
IPR007023   Ribosom_reg       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR034653   SPF45_RRM       
IPR003954   RRM_dom_euk       
IPR000467   G_patch_dom       
IPR040052   RBM17       
IPR035979   RBD_domain_sf       
IPR030223   Dispatched       
IPR003392   Ptc/Disp       
IPR000731   SSD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF56219   SSF56219        + More
SSF54928   SSF54928       
SSF57667   SSF57667       
SSF57903   SSF57903       
Gene 3D
PDB
6AR3     E-value=6.77553e-06,     Score=122

Ontologies

Topology

Length:
915
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01532
Exp number, first 60 AAs:
0.000600000000000001
Total prob of N-in:
0.00084
outside
1  -  915
 
 

Population Genetic Test Statistics

Pi
14.090313
Theta
11.539855
Tajima's D
0
CLR
1.278557
CSRT
0.377231138443078
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号