SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10941
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.579
 

Sequence

CDS
ATGCGCAAAAGTGTCAGGTACCACCGCCTCTCGGCTACGACTGGGTCCTTCGGCTACGACTGGGTCCTGCGGGGTGCCCTTCACAGCCCTCTCCCGGGCCTACGCGTTGTGTGTTACGCGGATGACACGTTAGTCATAGCTCGGGGGAAAGACTACCATGAGTCTGCCCGTCTTGCCTGCGCAGGGGTGGCATTCGTCGTCGGTAATATTCGGAGGTTGGGCCTCGAGGTGGCGCTCGAAAAATCCCAGGCCCTGCTGTTTCACAGGGCTGGAAGAGAGCCGCCGCCCGGGGCCCACCTGGTGATTGGAGGCGTCCGCGTCGAGGTTGGGGTAACCGGGTTGCGGTACCTCGGCCTCGAATTGGACGGTCGTTGGAACTTCCGCGCTCACTTCGAGAAGTTAGGCCCTCGGCTGATGGCGACGGCTGGCTCGTTGAGCCGGCTCTTGCCAAACGTTGGGGGGCCCGACGCAGTAGTACGTCGTCTCTACGTGGGGGTGGTGCGGTCCATGGCACTATATGGGGCCCCCGTGTGGTGCCGCGCCCTGACTCGCAGGAACATCGCGGCCCTGCGACGCCCGCAGCGTGCAATCGCGGTCAGGGCGATCCGTGGATACCGCACTGTCTCCTTCGAGGCGGCGTGCGTTCTCGCCGGGACGCTTCCCTGGGACCTGGAGGCGGAGGCACTCGCCGCCGATTATGCGTGGCGATGTGACCTTCGCGACAGGGGGGAACCACGTCCCGGAGAAGGAGCGATTAGAGCGCGGAGGCTCCAATCTCGGCGGTCTGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGAACCCGTCGGCCGGTCTCCGGACCGTCGAGGCGGTGCGCCCGGTCCTCGCGGAATGGGCGAACCGTGACCAAGGGCGTCTCACCTTCCGGTTGACGCAGATGCTTACCGGCCATGGGTGTTTTGGCCGGTACCTGCATCGCATCGCCCGGAGGGAACCGACGATGGAGTGTCAGATGGAGTGTGACTGCGACGAGGACACGGTCGAGCATACGCTCGCATATTGCCCCGCATGGCTGGAGCAACGCCGTGTCCTTGTCTCGCAAATAGGACCGGACTTATCGCTACCGACCGTCGTGGCCACGATGCTCGGCAGCGATGAGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTACACCATCTCGCAGAAGGAGGCGGCGGAACGAGAGAGGGAGAGCTCATCCCTCTCCGCACCTATCCGTCGCCGCCGAGCCGGGGGCCGGAGAAGGGCCTTTGCCCGACTCCGGCCCCTGTAG
Protein
MRKSVRYHRLSATTGSFGYDWVLRGALHSPLPGLRVVCYADDTLVIARGKDYHESARLACAGVAFVVGNIRRLGLEVALEKSQALLFHRAGREPPPGAHLVIGGVRVEVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDAVVRRLYVGVVRSMALYGAPVWCRALTRRNIAALRRPQRAIAVRAIRGYRTVSFEAACVLAGTLPWDLEAEALAADYAWRCDLRDRGEPRPGEGAIRARRLQSRRSVLEAWSRRLANPSAGLRTVEAVRPVLAEWANRDQGRLTFRLTQMLTGHGCFGRYLHRIARREPTMECQMECDCDEDTVEHTLAYCPAWLEQRRVLVSQIGPDLSLPTVVATMLGSDESWKAMLDFCEYTISQKEAAERERESSSLSAPIRRRRAGGRRRAFARLRPL

Summary

EMBL
AB090825    BAC57926.1    KZ150386    PZC71062.1    AB078935    BAC06462.1    + More
AB078931    BAC06456.1    AB078930    BAC06454.1    AB078929    BAC06452.1    RSAL01000481    RVE41577.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    LBMM01008861    KMQ88580.1    LBMM01014132    KMQ85305.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    LBMM01006671    KMQ90407.1    LBMM01019838    KMQ83439.1    LBMM01006725    KMQ90373.1    LBMM01004272    KMQ92618.1    GL450953    EFN80213.1    LBMM01007036    KMQ90099.1    LBMM01006657    KMQ90417.1    RSAL01003504    RVE40273.1    LBMM01005733    KMQ91252.1    LBMM01006063    KMQ90967.1    LBMM01008682    KMQ88705.1    LBMM01004634    KMQ92224.1    QOIP01000010    RLU18098.1    LBMM01002052    KMQ95336.1    LBMM01015018    KMQ84954.1    LBMM01008448    KMQ88867.1    LBMM01003245    KMQ93755.1    LBMM01004505    KMQ92346.1    QOIP01000031    RLU14697.1    LBMM01005216    KMQ91703.1    LBMM01004697    KMQ92167.1    LBMM01008349    KMQ88951.1    LBMM01002480    KMQ94776.1    LBMM01015025    KMQ84953.1    LBMM01009738    KMQ87908.1    LBMM01007425    KMQ89740.1    LBMM01014956    KMQ84982.1    LBMM01005948    KMQ91066.1    GGMR01012534    MBY25153.1    LBMM01007659    KMQ89538.1    LBMM01003988    KMQ92922.1    LBMM01014122    KMQ85315.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    GGMR01005740    MBY18359.1    KMQ94772.1    LBMM01005474    KMQ91485.1    LBMM01006496    KMQ90570.1    LBMM01005465    KMQ91492.1    ABLF02011238    ABLF02041886    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02016099    ABLF02041594    GFXV01003903    MBW15708.1    GECU01032129    JAS75577.1    GGMR01004600    MBY17219.1    LBMM01008422    KMQ88894.1    ABLF02005203    ABLF02041316    GGMR01019609    MBY32228.1    GGMR01011682    MBY24301.1    GFXV01001748    MBW13553.1    GGMR01015159    MBY27778.1    APGK01005465    KB736249    ENN83233.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    AB090814    BAC57904.1    AB593321    BAK38639.1    KQ972691    KXZ75806.1    ABLF02023401    ABLF02029423    ABLF02060278   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
429
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.57162
Exp number, first 60 AAs:
0.11094
Total prob of N-in:
0.06034
outside
1  -  429
 
 

Population Genetic Test Statistics

Pi
12.081789
Theta
15.071664
Tajima's D
0.016836
CLR
5.045151
CSRT
0.387430628468577
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号