SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10939
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.712 PlasmaMembrane   Reliability : 1.245
 

Sequence

CDS
ATGCCATTTTCTGTTAAGCTTTCCTACCAAGTAGAGATAACTCGGCAGCTGCCTATTCGCAAAGCACCAATTCCAAATACCGTCTTGGGGGATATAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATTGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTGTCGAAGCTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAGCTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGTTAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATTGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCGGTCTCACGGATCGTTTGGAACCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGGTCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MPFSVKLSYQVEITRQLPIRKAPIPNTVLGDIALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSKWGELNLVQFNPLKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPGLTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

EMBL
AY359886    AAQ57129.1    RSAL01002067    RVE40593.1    RSAL01000422    RVE41792.1    + More
RSAL01000002    RVE54942.1    RSAL01000090    RVE48098.1    GDRN01105059    JAI57791.1    DPOC01000269    HCX22453.1    GFAC01000919    JAT98269.1    GDRN01111334    JAI56796.1    GEFM01006417    JAP69379.1    NSIT01000412    PJE77717.1    NSIT01000218    PJE78268.1    GDRN01111277    JAI56804.1    GEFM01002394    JAP73402.1    GFAA01002514    JAU00921.1    NEDP02002425    OWF50811.1    GEGO01003312    JAR92092.1    NSIT01000271    PJE78081.1    GEGO01001118    JAR94286.1    NSIT01000477    PJE77602.1    NSIT01000462    PJE77627.1    FLMD02000280    SCV66640.1    NSIT01000239    PJE78188.1    NSIT01000538    PJE77518.1    GEFM01006421    JAP69375.1    GFAA01002385    JAU01050.1    GFAC01005670    JAT93518.1    NSIT01000164    PJE78524.1    NSIT01000532    PJE77527.1    AAGJ04096877    GFAC01005653    JAT93535.1    AAGJ04095885    FLMD02000154    SCV66010.1    GEGO01004061    JAR91343.1    GFAC01005646    JAT93542.1    AAGJ04090645    GFAC01005665    JAT93523.1    GEGO01003111    JAR92293.1    GEGO01003518    JAR91886.1    MRZV01000639    PIK46517.1    GFAC01000861    JAT98327.1    GEGO01003427    JAR91977.1    GEGO01004056    JAR91348.1    NSIT01000225    PJE78229.1    NEDP02004020    OWF47171.1    NSIT01000539    PJE77517.1    AGCU01081420    AGCU01164164    AGCU01168427    AGCU01046616    AGCU01055496    GEGO01004295    JAR91109.1    AGCU01096477    GEFM01002324    JAP73472.1    KZ505886    PKU43598.1    AGCU01135984    AGCU01190758    AAGJ04119818    AGCU01003726    AGCU01156992    AGCU01018596    NSIT01000234    PJE78200.1    KZ506232    PKU40632.1    AGCU01061849    AGCU01002265    GFAA01002479    JAU00956.1    AGCU01156312    AGCU01115937    GEGO01002473    JAR92931.1    AGCU01119662    AGCU01001404    AGCU01038874    AGCU01124718   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01585   G-patch
PF04939   RRS1
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR034653   SPF45_RRM       
IPR003954   RRM_dom_euk       
IPR000467   G_patch_dom       
IPR040052   RBM17       
IPR035979   RBD_domain_sf       
IPR007023   Ribosom_reg       
SUPFAM
SSF56219   SSF56219        + More
SSF54928   SSF54928       
Gene 3D

Ontologies

Topology

Length:
425
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04123
Exp number, first 60 AAs:
6e-05
Total prob of N-in:
0.00447
outside
1  -  425
 
 

Population Genetic Test Statistics

Pi
201.196731
Theta
69.845403
Tajima's D
0.817974
CLR
17.78281
CSRT
0.602669866506675
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号