SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10917
Annotation
PREDICTED:_uncharacterized_protein_LOC105396011_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.616
 

Sequence

CDS
ATGGATGAACTTTTGAATGTTTTAGAAGATACCGCTGCGCTCTTAAACAAAACTCAAATTAATTTAAAGAAATGTCCAAAAGCTAGATTGACAAGAGGTTATGTAGAAGCAAGAATCAAATGTATCGAAGAATATTGGACTACATTTAAGCAAACGCATCTACAATTGGTAAAAATAACACCGAAAGAACAAAGACAAGAGTTACCATATTTTCAAAATGAAGATTACTTCGTGTTCGAAGATTTGTATCTCGTCTTGTTAGCCGATTTAAAAGATCTTTTGCAATCTTTCACACAAGCAGCCGCGCCGAGTACTTTAACGTCCTCACCAAATATTTCTAAGATTATTGCGGATACCGAAAACCTTGTTCGGTTACCGAGAATCGAATTACCTAAATTCACTGGAAACTATGAAGATTGGCCTACGTTTCAAGACCTATTTACCTCCTTAGTGGATAAGAACCCGGCTTTAAGTGACGTACAAAAGTTACATTATCTTAAGAGTACAGTCAGCTGCGAGGCAGAAACATTATTAAAACCTGTTCAAGTCACGGAAAACAATTATAAAAAAGCATGGAATATTTTGAAGTCAAGGTATGGAAATAAAAGATTAATAATTAACTCAGTTTTGAAGAAATTATTTAATCAGAAGAAAATTAGTTCTCAGTCTGCAAATCAATTAAAAAATTTATTAGACGTCACGACAGATTGTTTGAATAATTTAGAAAATTTAAATATAGCTACGAGCTCCTGGGATCCTATAATTATATTCCTTGTGATACAGAAGTTGGACCCGGAGTCTCACAAAGAATGGGAGCAGACAGCTTATTCAAAATCAGAGGACGAACTACCAACTTGGGAGAATTTAAAAGATTTCCTGCAGTCAAGATACCGTACCTTAGAACTTGTATTGTCCGTGTCAGGGACTTGTAGCAGCCGTGACAAACCTGTAAGAGAACGTTCACACTTAGTCACTGCCACAGCTACCACGTCACAGCCAAATGAAAGAACTTGCGTGCTCTGTAAAGAAAAGCATACATTATGTCATTGTAAGAATTTTACCACACTGCAACCTACAAAAAGAGCTGATTATGTCAAGACCAAAAATCTGTGTTTTAACTGTTTGGTGCCTGGGCATTCTGCTTACCAGTGTAAGTTACAAATGTCCTGTCGCCTATGTAGAAGACGACATCACACTCTTCTCCACCGCCATCAAGACTCGGCACAAACTGAGGAAAGGAATCAACCGAGTGCATCTCACCACGGGGTAGAAGAGAAAGAAGAGGTTATAAATAGCATGGTGGCGTCACATCACAGTACTAAACAAAGCACAGCACTACTAGCCACAGCGATGGTTTTAGCGAGGAACGAGCATAACCAAACCGTTGTTCTTCGTGCGCTAGTAGACCAAGGTTCGCAGGCTTCATTTTTAAGCGAGAAGGCGGCTCAAATGCTCAAACTTAACAGGCAACCAGCAAGAGGAAGTATCATCGGGGTAGGATCTACTAGGACTAACGTTGATCACATGGTTCAACTTAAGATTGGCTCCCGCTGGAATCCAAGCTTCGAAATCAACATACAAGCATATGTTATGAGTAAACAGTTGACCACGAAGATCCCCTCCAAAGCTGTAACTGTCACACATTGGCCACATCTAGAAGGACTCAACCTGGCAGATCCAGACTACTTCCAACCAGGTTCTATAGACTTACTTCTTGGTGTTAAAGAGTATGCACAGATTGTGCAACCAACACTTATTAAGGGCCCTCCAGGTTCTCCGTGTGCCCAAGAAACTAACCTGGGGTGGATCCTCTTCGGGGAAATCGATAATAACCGTGAAAATGAATCATTTCTGGTCCTTCATCATCAAGTCCATATAGATCATATGTTGAAATCCCTCTGGGAAATTGACAATGATAAAAAGAGAATATTAACAAAGGAAGAAAAGCTATGTGAAACAATATATGAAAAAACACATACGAGAAATAGTGAAGGAAGATATCTAGTAAGGCTGCCATTTAATACAAATAATCCAATTTCGACTGAAGGAAATACGAAAGAAATAGCTAGAAAAAGGTTACTTCAACTAGAAAGAAGATTTAAGAAAGAAACTAAACTGAAAGAAGATTATACAAAGGTCATGCAAGAATACATAAAAGCTAACTACATGGAAGAAATACCTAAGAATGAAATAAACAAGAAAAAATCAGTATACTTACCTCATCACGCCGTGGTACACGCAGACAGAGAAACTTCTAAGACACGCGTAGTATTTGATGCTTCAGCGAAGGGCTCTAACTGCGTTTCTCTAAACGATGAATTGCTTGTAGGTCCGCAACTGCAAGAGGACTTAAGGAACATACTTATGAGATCGAGATTACATCGTGTTTGCTATGCAAGTGATATACAAAAGATGTACCTGCAAATATTACTTTATGAAGAAGACGCCGATCGATATCAACGCCTTTTGTGGAGAGAGAATGATTCAGACCCGATTAAAGAATATCGTATGCTTCGTGTTACATTTGGTACAGCGGCGGCCCCTCACCTGGCTGTAAGAACGCTTCACCAGGTAGCTGACGATGAGGGTCGAAATCATCCAATGGCTGTTCGAATTATTAAAGAAGATTTTTACATGGACGATCTAATGTCGGGGGAGAGCAGTGCTCCTGAAACCATAAAGAGAGCACAAGAAGTAGATAATATTCTACAGAAAGGTGGATTTGTATTATCAAAATGGTCATCCAATTCTGCTGAATTTTTGAAATCTATCGAACCAAACAAAAGGACATCTCGAGCACAGTTGGATTTTAAATTGGATGGAAAAGTACAAGCTCTAGGTTTGATCTGGAACCTGGGCACGGATCAGTTTCAGTACAAGGTTAACTTACCAGCAAAGTCAAGCAGTATTACAAAGAGAGGCATACTATCTGATATTCAAAGACTTTTTGACCCACTGGGATGGATCGCCCCTAGCTTAATTTTGGCTAAGATACTCATACAAAGGCTATGGCTAGAACCGATTGGCTGGGATGACGAGATTAACCAATCGCTGTTACACGATTGGCTGACAATTAGAGAAGACTTTGAACATGTAAAAGAGATAGGTATTCCAAGATGGCTAAACACAGTAAGCACACAGATGGAAAACATCGAGGTTCATGGTTTCAGTGATGCTTCCATGAAAGCCTATGCCGCGGTGGCTTACATTCGTGTGAAGAGGGAAGATGGTTCAGTATTCACCAATCTATTAGCTGCCCGTACTAGAGTGGCACCACTCCGTACCGTGTCTCTACCACGCCTGGAGTTATGTGGGGCGCTGTTATTAGCAAGGTTACTTAAGCAAATAGAAAATGCAATGCGTATACCTACTTCTAACATCTATGCATGGACAGATTCATCAATTGTTCTTGCATGGCTATCTGGTGATCCTCATAGATGGAAGACATTCGTGGCGAACCGGGTCGTAGAAATTGTAGAAAATGTAAACACACACCGATGGTTCCATGTAGCTTCGGAAGAGAATCCTGCAGACATCGGGTCGCGGGGCATGCTGCTGGCGGACTTGAAACAGAAAGAGTTATGGTGGACAGGGCCCAAGTGGTTATGCAAAAAAGAAATAATATACAGTAAGCCAGGAATAACAGAAACAGAATTAGAAATGAAAACAATAAAATTAAATACTTACCACAATGCAGAAGAACTAAAACCTTTAACCGCTCAGTTTGAAGATTTTGATACGTTACCAGAATTACTAAAAACTATTATTTACTGTAAAAGATTTCTAAGATACAAAAGTAATTTAAGTACGAGCAAGGAAATAACTACACAAGAATTAGAAGACGCGCTTATCACATGCATTAAGTTAGTACAACAAGAATTCAAAGAAGAAATAGATCGGCTAAGAGATAAGAAACAAGTTAGAAGAAAAAGTTTCAACAAAAGGTCGGATTAA
Protein
MDELLNVLEDTAALLNKTQINLKKCPKARLTRGYVEARIKCIEEYWTTFKQTHLQLVKITPKEQRQELPYFQNEDYFVFEDLYLVLLADLKDLLQSFTQAAAPSTLTSSPNISKIIADTENLVRLPRIELPKFTGNYEDWPTFQDLFTSLVDKNPALSDVQKLHYLKSTVSCEAETLLKPVQVTENNYKKAWNILKSRYGNKRLIINSVLKKLFNQKKISSQSANQLKNLLDVTTDCLNNLENLNIATSSWDPIIIFLVIQKLDPESHKEWEQTAYSKSEDELPTWENLKDFLQSRYRTLELVLSVSGTCSSRDKPVRERSHLVTATATTSQPNERTCVLCKEKHTLCHCKNFTTLQPTKRADYVKTKNLCFNCLVPGHSAYQCKLQMSCRLCRRRHHTLLHRHQDSAQTEERNQPSASHHGVEEKEEVINSMVASHHSTKQSTALLATAMVLARNEHNQTVVLRALVDQGSQASFLSEKAAQMLKLNRQPARGSIIGVGSTRTNVDHMVQLKIGSRWNPSFEINIQAYVMSKQLTTKIPSKAVTVTHWPHLEGLNLADPDYFQPGSIDLLLGVKEYAQIVQPTLIKGPPGSPCAQETNLGWILFGEIDNNRENESFLVLHHQVHIDHMLKSLWEIDNDKKRILTKEEKLCETIYEKTHTRNSEGRYLVRLPFNTNNPISTEGNTKEIARKRLLQLERRFKKETKLKEDYTKVMQEYIKANYMEEIPKNEINKKKSVYLPHHAVVHADRETSKTRVVFDASAKGSNCVSLNDELLVGPQLQEDLRNILMRSRLHRVCYASDIQKMYLQILLYEEDADRYQRLLWRENDSDPIKEYRMLRVTFGTAAAPHLAVRTLHQVADDEGRNHPMAVRIIKEDFYMDDLMSGESSAPETIKRAQEVDNILQKGGFVLSKWSSNSAEFLKSIEPNKRTSRAQLDFKLDGKVQALGLIWNLGTDQFQYKVNLPAKSSSITKRGILSDIQRLFDPLGWIAPSLILAKILIQRLWLEPIGWDDEINQSLLHDWLTIREDFEHVKEIGIPRWLNTVSTQMENIEVHGFSDASMKAYAAVAYIRVKREDGSVFTNLLAARTRVAPLRTVSLPRLELCGALLLARLLKQIENAMRIPTSNIYAWTDSSIVLAWLSGDPHRWKTFVANRVVEIVENVNTHRWFHVASEENPADIGSRGMLLADLKQKELWWTGPKWLCKKEIIYSKPGITETELEMKTIKLNTYHNAEELKPLTAQFEDFDTLPELLKTIIYCKRFLRYKSNLSTSKEITTQELEDALITCIKLVQQEFKEEIDRLRDKKQVRRKSFNKRSD

Summary

EMBL
ODYU01008608    SOQ52337.1    RSAL01000327    RVE42512.1    KQ460036    KPJ18393.1    + More
KQ458473    KPJ05885.1    GEZM01060254    JAV71154.1    LBMM01008464    KMQ88855.1    LNIX01000036    OXA39969.1    LNIX01000007    OXA51795.1    LBMM01009645    KMQ87967.1    LBMM01008324    KMQ88972.1    GAMC01003146    JAC03410.1    LBMM01011051    KMQ87060.1    LNIX01000016    OXA46198.1    LBMM01011492    KMQ86800.1    LBMM01009964    KMQ87756.1    LBMM01010417    KMQ87475.1    LBMM01011516    KMQ86784.1    LNIX01000002    OXA60848.1    LBMM01010405    KMQ87487.1    LBMM01009551    KMQ88039.1    LBMM01007859    KMQ89359.1    LBMM01011283    KMQ86917.1    OXA51382.1    LNIX01000003    OXA58579.1    LNIX01000018    OXA45284.1    LNIX01000001    OXA61293.1    LBMM01009888    KMQ87813.1    LNIX01000044    OXA38660.1    LBMM01012077    KMQ86420.1    AJ487856    CAD32253.1    NWSH01000070    PCG79985.1    LBMM01009688    KMQ87939.1    ABLF02022040    ABLF02056888    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    GFTR01008874    JAW07552.1    LNIX01000026    OXA42254.1    GBBI01004140    JAC14572.1    GBBI01004139    JAC14573.1    OXA59522.1    KK114194    KFM61875.1    LNIX01000005    OXA54553.1    OXA54559.1    GGMR01014413    MBY27032.1    GGMR01018506    MBY31125.1    ABLF02023723    ABLF02004142    LBMM01007770    KMQ89434.1    GGMR01020322    MBY32941.1    ABLF02035780    ODYU01012875    SOQ59395.1    ABLF02023842    ABLF02028949    ABLF02058391    ABLF02016109    ABLF02016113    ABLF02030854    ABLF02067347    ABLF02066034    GEHC01000870    JAV46775.1    GEZM01012999    JAV92824.1    ABLF02008594    ABLF02042264    GGMR01013586    MBY26205.1    ABLF02005684    KZ150008    PZC75149.1    ABLF02042806    CR954257    CAJ14165.1    EF426679    ABP48078.1    GGMS01010524    MBY79727.1    GEHC01000869    JAV46776.1    KQ460500    KPJ14270.1    GGMR01020500    MBY33119.1    ABLF02018588    ABLF02018590    ABLF02042430    GGMS01005792    MBY74995.1    ABLF02007122    ABLF02033517    LNIX01000027    OXA41905.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GBBI01004211    JAC14501.1    LBMM01009202    KMQ88311.1    ABLF02041590    ABLF02016099    GBBI01004408    JAC14304.1    GBBI01004410    JAC14302.1    ABLF02041505    GAMC01020552    JAB86003.1    GGMS01010815    MBY80018.1    GGMR01002340    MBY14959.1    GEZM01066272    JAV68024.1    GEHC01000877    JAV46768.1    JXUM01113346    KQ565681    KXJ70776.1    GGMR01017803    MBY30422.1    GAKP01007887    JAC51065.1    LBMM01012238    KMQ86334.1    DNYX01000039    HBK82233.1    LNIX01000012    OXA48073.1    GAMC01006864    JAB99691.1    GALX01003264    JAB65202.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00008   EGF
PF00078   RVT_1
PF00665   rve
PF02145   Rap_GAP
PF00230   MIP
PF12259   Baculo_F
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000253   FHA_dom       
IPR000742   EGF-like_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR013032   EGF-like_CS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000033   LDLR_classB_rpt       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR000727   T_SNARE_dom       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF111347   SSF111347       
SSF81338   SSF81338       
SSF57756   SSF57756       

Ontologies

Topology

Length:
1317
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01071
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1317
 
 

Population Genetic Test Statistics

Pi
148.54495
Theta
163.274989
Tajima's D
-1.128125
CLR
0.138483
CSRT
0.121493925303735
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号