SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10878
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.342
 

Sequence

CDS
ATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACCCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCATACTAGGTGGAACTGCCACAGTTCAAACATAAACGGTAGGCGTCTCGACGCGTTTATAGATGACCTTACCTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCCCACAACCCAGTCACAGCTACGAGGACCATGGTGGACTGGAAGAAGCTGGGCAAATGCTTAGCCGATGCCGCTCCACCAATCCTCCCCTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACAGTCGAATCCATAAACATCATCACGGATCACATCTCTTCCGCGATCATAAGATCCTCAAAAGAAGTCGATGTGGAGGATAGCTTCCACCGCATCAGACTGTCCCCCGAACTTAGGAACCTCCTAAGAGTTAGAAACGCGGCAATCCGGGCCTACGATCAACTTCCCACGCACTCAAACCGGATTCGGATGCGTCGTCTACAGCGGGATGTAAAATCTCGCCTAAGCGACGCCCGAAATGAGAATTGGGATAGTTACTTAGAAGGACTCGCGCCCTCTCATCAAGCATACTGGCGACTAGCAAGGACTCTCAAGTCCGAAACTACCGCTACTATGCCTCCTCTCGTACGCCCTTCAGGCCAACCACCGGCTTTCGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAATACGCGGACCCCGAACACACCGAGGCAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCACCCTCGGACGCGTTACCCCCCATTACCTCTGACGAAGTTAGAGAAGTAATAGATAACCTTCAACCTAAGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGTTAAAACTCTTACCAGTCCAACTGATAACAATGTTGGCTACCATCTTAAATGCCGCTATGACGCACTGCATCTTTCCGGCGGTATGGAAAGAAGCGGACGTTATCGGTATACACAAGCCGGACAAACCGAATAATGAAACCGCTAGTTACCGACCGATTAGTCTCCTCCCAGCGATAGGCAAAATTTACGAACGGCTCCTTCGGAAACGCCTCTGGGACTTCGTTACCGCGAATAAAATTCTAATAGACGAGCAGTTTGGATTCCGCGCCAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCTTAATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATGTAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTATCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCATCTGACTGCCGGAGTCCCGCAAGGCTCCGCACTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGTTGCTTCATCGGCGACTCCAGACCGCAGTAACCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATTAACCCACGAAAAGCACAGCGGTGCTATTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCACCCCACTCCCCAGTAGGCGCGTAA
Protein
MVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHSSNINGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTATRTMVDWKKLGKCLADAAPPILPCGPDSTPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPELRNLLRVRNAAIRAYDQLPTHSNRIRMRRLQRDVKSRLSDARNENWDSYLEGLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQYADPEHTEAVDREVERRASLPPSDALPPITSDEVREVIDNLQPKKAPGSDGIRNRALKLLPVQLITMLATILNAAMTHCIFPAVWKEADVIGIHKPDKPNNETASYRPISLLPAIGKIYERLLRKRLWDFVTANKILIDEQFGFRAKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDVAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRHLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQTAVTTMGQWFRKWRIDINPRKAQRCYSKGVALRIPLRAPHSPVGA

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ973342    KXZ75569.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973412    EFA12510.2    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GALX01005299    JAB63167.1    GGMR01013409    MBY26028.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    GGMS01002992    MBY72195.1    S59870    AAB26437.2    GALX01005359    JAB63107.1    KQ973363    EFA13335.2    L79944    AAB04627.1    ABLF02023911    RPOV01000134    RPJ78669.1    ABLF02034467    NEVH01005277    PNF39135.1    GGMR01004661    MBY17280.1    GFTR01008279    JAW08147.1    GFTR01008271    JAW08155.1    NEVH01021205    PNF19912.1    NEVH01011985    PNF31054.1    NEVH01006736    PNF36716.1    ABLF02024246    GFTR01008262    JAW08164.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01023280    PNF18085.1    GGFL01004957    MBW69135.1    GFTR01008261    JAW08165.1    GGFL01005012    MBW69190.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GGMR01002322    MBY14941.1    GGMR01003407    MBY16026.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMS01017365    MBY86568.1    GGMR01012305    MBY24924.1    ABLF02028535    ABLF02028545    GFTR01008269    JAW08157.1    KF280391    AIE77315.1    GFTR01008151    JAW08275.1    GFTR01008256    JAW08170.1    NEVH01017470    PNF24199.1    GFTR01008260    JAW08166.1    GGMS01002786    MBY71989.1    GBGD01000389    JAC88500.1    GGMR01012443    MBY25062.1    GFTR01007929    JAW08497.1    GGFJ01002256    MBW51397.1    GGMR01000676    MBY13295.1    GGMR01015412    MBY28031.1    KK118005    KFM71947.1    GGFJ01002257    MBW51398.1    GGMR01012283    MBY24902.1    GFTR01008251    JAW08175.1    AJWK01012157    GGMR01000226    MBY12845.1    KK119261    KFM75202.1    GGMR01016905    MBY29524.1    GGMR01006408    MBY19027.1    GFTR01008254    JAW08172.1    GGMR01020516    MBY33135.1    GDHC01018248    JAQ00381.1    LBMM01018163    KMQ83860.1    GFTR01008257    JAW08169.1    ABLF02016634    KK113281    KFM59799.1    GECL01003538    JAP02586.1    GEZM01053022    JAV74219.1    NEVH01026386    PNF14434.1    NEVH01002556    PNF42024.1    GEZM01084969    JAV60363.1    AY060438    AAL25477.1    ABLF02021819    ABLF02021820    ABLF02055326    GFXV01002840    MBW14645.1    M38437    GEDC01029594    JAS07704.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01022639    PNF18527.1    RSAL01000708    RVE41206.1    ABLF02022418    GFTR01007904    JAW08522.1    GGMR01012676    MBY25295.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0102806,     Score=94

Ontologies

Topology

Length:
687
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.942669999999999
Exp number, first 60 AAs:
0.00737
Total prob of N-in:
0.01055
outside
1  -  687
 
 

Population Genetic Test Statistics

Pi
0.000438
Theta
0.004133
Tajima's D
0
CLR
1.031121
CSRT
0.00829958502074896
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号