SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10877
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.125
 

Sequence

CDS
ATGGAAGCTTTATTTTCAGAATTCCTCCGACTTCGCCACCCAAAGCTCACTTCTGAGTTTCTGGCTTTCAAGGCCGATCACGCCGTGAGCCCTCTCGCGGATTCCGCCGTGCTCGTCGCTCCCGCGTCGTACACCGCAGCGTCCGCCATACCTGCCGCTCCCGCGTCGCCTATACTAGTGGGTAAAACTGCTGCGTCGTCCGCCGTGGCCGCTGCTCCCCTGGCGCGATCATCCGCGGGTTCCGTAGGGTCCGACGGACGTCCTGCATCTGCCCGTAGGTCGCCTGCTCCCGAGCCTGCTGCCTTCTCGTCCTCCGACTCTGACTCAGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAAAAGGGTAAGAAGCGCGCTGCGGAGTCCCAAACTCCCGCGGCCGCTAAAATTATTAAAGCCGCGAACGCGTCGCGCCCTCGCCCTCCGACTCCCGTCGCTCCCCCTGCCCGTGCCACACCGTCGCCGCGTCCAGTGGCACAAAATAAAACTCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGACCGAGTTTCCCTGGCCCTTCAGGCCAAAAAAATTAATTTTATCAGCGCCCGTAACCTCGCGAACGGGATTCAAATTAAGTTAACGACACCCGATGACCATAGGGCCCTCTCAAGCTACCTCCGAAAGGAGCGTATAAGTTTCCACACTTATACGCTTCAGGAGGAGCGTGAACTTCGCGCGGTCATACGCGGCATCCCAAAGGAATTAGATGCCGATCTCATCAAGGCAGACCTTCTAGAACAAGGTTTGCCGTCGATCAACTTTGATCGCGTTAATGCTTTGGGCGACGCCATTCGCGCCGCCTCCACTGCACAACACTTCATCGCCGTTGTGCAAGAATACGCTGACGTATACGCGTCGTTAAATACGTGGAACTCTCACACCTCAACCCCTAATGGCAGGCGCCTCGACGCGTTAGTCGATGATCTCGCCTTTGATATCGTCGCTCCGCTGACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTAAATTCGATTGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGTGCATCAGCCTTGCTGAATCTGATCCACCATCGCTTCCGTTTAGTCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGATGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGCGTACGATAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCACCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCTCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATAACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAGCCCAGTGCATGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTTGGACGCGTTACTGCCCGTCACCTCAATGGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTTTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCTAACTGTATCTTTCCCACGGTGTGGAAAGAAGCGGACGTTATCGGCATACACAAACCCGGTAAACCAAAAAATAATCCGACGAGTTATCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGACTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGAGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTGCCGCAAGGCTCCGTTCTCTCACCGCTCCTATTTAGTTTATTTATTAATGATATTCCCCGGTCGCCGCCGACCCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAACTCCAGAGCGCAGCGTTAGCCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCGGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACTCCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGTCAGGAAGGTTAAGTACCTGGGAGTCACCCTGGATGCATCTATGACATTCCGCCCACACATAAAAACAGTCCGCGACCGTGCCGCATTCATTCTCGGCAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGAAACAAGGTGACACTATACAAAACTTGCATAAGGCTCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCGCATACATAGACACCCTCCAATCCCTACAGTCCCGCTTTTGCAGGTTAGCCGTCGGAGTTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCTTCGAATCAATCCGGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGGGTCATGATAATTGCCTTATCGTTGCCGCAGCTGACTACTCCTCGAATCCTGATTACACAAGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCAGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAG
Protein
MEALFSEFLRLRHPKLTSEFLAFKADHAVSPLADSAVLVAPASYTAASAIPAAPASPILVGKTAASSAVAAAPLARSSAGSVGSDGRPASARRSPAPEPAAFSSSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESQTPAAAKIIKAANASRPRPPTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVSLALQAKKINFISARNLANGIQIKLTTPDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDADLIKADLLEQGLPSINFDRVNALGDAIRAASTAQHFIAVVQEYADVYASLNTWNSHTSTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLNSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLCISLAESDPPSLPFSPDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRITEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDNEKAELLADTLQAQCMPSIQSADPVHVELVDSEVERRASLPPLDALLPVTSMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPTVWKEADVIGIHKPGKPKNNPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFINDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWVRKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRLVMTYASVVFAHAARAYIDTLQSLQSRFCRLAVGVPWFVRNVDLHDDLGFESIRKYMKSASERYFDKAMGHDNCLIVAAADYSSNPDYTRASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPSNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0362688,     Score=91

Ontologies

Topology

Length:
1125
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.79336
Exp number, first 60 AAs:
0.00612
Total prob of N-in:
0.00033
outside
1  -  1125
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.005594
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号