SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10876
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.749 Nuclear   Reliability : 1.95
 

Sequence

CDS
ATGCAGCTCGGTCGCCCCCACAACCCAGTCACAGCTACGAGGACCATGGTGGACTGGAAGAAGCTGGGCAAATGCTTAGCCGATGCCGCTCCACCAATCCTCCCCTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACAGTCGAATCCATAAACATCATCACGGATCACATTTCTTCCGCGATCATAAGATCCTCAAAAGAAGTCGATGTGGAGGATAGCTTCCACCGCATCAGACTGTCCCCCGAACTTAGGAACCTCCTAAGAGTTAGAAACGCGGCAATCCGGGCCTACGATCAACTTCCCACGCACTCAAACCGGATTCGGATGCGTCGTCTACAGCGGGATGTAAAATCTCGCCTAAGCGACGCCCGAAATGAGAATTGGGATAGTTACTTAGAAGGACTCGCGCCCTCTCATCAAGCATACTGGCGACTAGCAAGGACTCTCAAGTCCGAAACTACCGCTACTATGCCTCCTCTCGTACGCCCTTCAGGCCAACCACCGGCTTTCGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCATTCAATACGCGGACCCCGAACACACCGAGGCAGTCGACGGGGAGGTCGAGCGCAGAGCTTCCCTGCCACCCTCGGACGCGTTACCCCCCATTACCTCTGACGAAGTTAGAGAAGTAATAGACAACCTTCAACCTAAGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGTTAAAACTATTACCAGTCCAACTGATAACAATGTTGGCTACCATCTTAAATGCCGCTATGACGCACTGCATCTTTCCGGCGGTATGGAAAGAAGCAGACGTTATCGGTATACACAAGCCGGGCAAACCGAATAATGAAACCGCTAGTTACCGTCCGATTAGTCTCCTCCCAGCGATAGGCAAAATTTACGAACGGCTCCTTCGGAAACGCCTCTGGGACTTCGTTACCGCGAATAAAATTCTAATAGACGAGCAGTTTGGATTCCGCGCCAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCTTAATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATGTAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCATCTGACTGCCGGAGTCCCGCAAGGCTCCGCACTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGTTGCTTCATCGGCGACTCCAGACCGCAGTAACCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATTAACCCCACGAAAAGCACAGCGGTGCTATTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCACCCCACTCCCCAATAGGCGCGTAAACACCTCCGCCGTTAGCCCCATCACTCTCTTTGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCACGTAAAAACGGTACGCGATCGCGCCGCGTTTATACTAGGACGACTCTACCCAATGCTTTGTAGACGAAGCAAACTGTCCCTCCGCAACAAGGTAACCCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCGGCCCGCACCAACTTGAAACCCCTTCAGGTTATACAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCAGAGGAACGTGGACCTCCACGATGACCTGGAGCTCGACCCCGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCACTTTGAGAAGGCGGCACGACATGAGAACCCTCTTGTCGTGGCCGCCGGAAACTACATACCCGATCCTGTAGACCGTTTGTCCTATCCTGTGATGTACCTTTATAACAGGAGTTCTGAAGAAGCATTTTTTACGGAACTCCTGCTCCAACATCAAGTTACGGAAATCGAGTAA
Protein
MQLGRPHNPVTATRTMVDWKKLGKCLADAAPPILPCGPDSTPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPELRNLLRVRNAAIRAYDQLPTHSNRIRMRRLQRDVKSRLSDARNENWDSYLEGLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSIQYADPEHTEAVDGEVERRASLPPSDALPPITSDEVREVIDNLQPKKAPGSDGIRNRALKLLPVQLITMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPNNETASYRPISLLPAIGKIYERLLRKRLWDFVTANKILIDEQFGFRAKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDVAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRHLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQTAVTTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSTPLPNRRVNTSAVSPITLFDQPIPWAPKVKYLGVTLDRGMTFRPHVKTVRDRAAFILGRLYPMLCRRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFQRNVDLHDDLELDPVSKYLQSASLRHFEKAARHENPLVVAAGNYIPDPVDRLSYPVMYLYNRSSEEAFFTELLLQHQVTEIE

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ971729    KYB24751.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    S59870    AAB26437.2    RPOV01000134    RPJ78669.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    GFTR01008038    JAW08388.1    GGMR01018716    MBY31335.1    GFXV01007093    MBW18898.1    ABLF02033757    NEVH01006736    PNF36716.1    GGMS01002992    MBY72195.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    NEVH01006721    PNF37225.1    GEZM01053022    JAV74219.1    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    NEVH01026386    PNF14434.1    GBBI01001646    JAC17066.1    GGMS01002955    MBY72158.1    GGMR01003407    MBY16026.1    ABLF02024246    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01020940    PNF20481.1    ABLF02008463    GFTR01008251    JAW08175.1    GBYB01008290    JAG78057.1    GGMR01000676    MBY13295.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01007443    PNF35684.1    GGFL01004957    MBW69135.1    ABLF02034467    GGFJ01001858    MBW50999.1    GFTR01008271    JAW08155.1    NEVH01003017    PNF40781.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    GGFJ01001857    MBW50998.1    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01023962    PNF17612.1    GGFL01005012    MBW69190.1    GFTR01008256    JAW08170.1    NEVH01018383    PNF23463.1    NEVH01005938    PNF38077.1    GBGD01000880    JAC88009.1    NEVH01010546    PNF32261.1    GEZM01074951    JAV64378.1    GBGD01000799    JAC88090.1    NEVH01020071    PNF21969.1    GEZM01084969    JAV60363.1    JRES01000644    KNC29657.1    GGMS01004444    MBY73647.1    NEVH01001355    PNF42855.1    NEVH01023961    PNF17613.1    NEVH01000269    PNF43694.1    KK119692    KFM76444.1    NEVH01019964    PNF22161.1    NEVH01020963    PNF20308.1    NEVH01000280    PNF43672.1    NEVH01002716    PNF41415.1    NEVH01014858    PNF27387.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0158548,     Score=92

Ontologies

Topology

Length:
721
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.414590000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01184
outside
1  -  721
 
 

Population Genetic Test Statistics

Pi
1.317238
Theta
3.079686
Tajima's D
-0.712726
CLR
0.231353
CSRT
0.197590120493975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号