SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10859
Annotation
PREDICTED:_uncharacterized_protein_LOC105396011_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.167
 

Sequence

CDS
ATGTCCTGTCGCTTATGTAGAAGACGGCATCACACTCTTCTCCACCGCCATCAAGACTCGGTACAAACTGAGGAAAGGAATCAACCGAATGCATCTCACCACGGGGTAGAAGAGAAAGAAGAGGTTATAAATAGCATGGTGGCGTCACATCACAATACTAAACAAAGCACAGCACTACTAGCCACAGCGATGGTTTTAGCGAGGAACGAGCATAACCAAACCGTTGTCCTTCGTGCGCTAGTAGACCAAGGTTCGCAGGCTTCATTTTTAAGCGAGAAGGCGGCTCAAATGCTCAAACTTACCAGGCAATCAGCGAGAGGAAGTATCATCGGGGTGGGATCTACTAGGACTAACGTTGATCACGTGGTTCAACTTAAGATTGGCTCCCACTGGAATCCAAGCTTCGAAATCAACATACAAGCATATGTTATGAGTAAACAGTTGACCACGAAGATCCCCTCCAAAGCTGTAACTGTCACACATTGGCCACATCTAGAAGGACTCAACCTGGCAGATCCAGACTACTTTCAACCAGGTTCTATAGACTTACTTCTTGGTGTTAAAGAGTATGCACAGATTGTGCAACCAACACTTATTAAGGGCCCTCCAGGTTCTCCATGTGCCCAAGAAACCAACCTGGGGTGGATCCTCTTCGGAGAAATCGATAATAACCGTGAAAATGAATCATTTCTGGTCCTTCATCATCAAGTCCATATAGATCATATGTTGAAATCCCTCTGGGAAATTGACAATGATAAAAAGAGAATATTAACAAAGGAAGAAAAGCTATGTGAAACAATATATGAAAGCACACATACGAGAAATAGTGAAGGAAGATATCTAGTAAGGCTGCCATTTAATACAAAGAATCCAATTTCGACTGAAGGAAATACGAAAGAAATAGCTAGAAAGAGGCTACTTCAGCTAGAAAGAAGATTTAAGAAAGAAACTAAACTGAAAGAAGATTATACAAAGGTCATGCAAGAATACATAAAAGCTAACTACATGGAAGAAATATCTAAGAATGAAATAAATGAGAGAAAATCAGTATACTTACCTCATCGCGCCGTGGTACACGCAGACAGAGAAACTTCTAAGACACGCGTAGTATTTGATGCTTCCGCGAAGGGCTCCAACTGCGTTTCTCTAAACGATGAATTGCTTGTAGGTCCGCAACTGCAAGAGGACTTAAGGAACATACTTATGAGATCGAGATTACATCGTGTTTGCTATGCAAGTGATATATAA
Protein
MSCRLCRRRHHTLLHRHQDSVQTEERNQPNASHHGVEEKEEVINSMVASHHNTKQSTALLATAMVLARNEHNQTVVLRALVDQGSQASFLSEKAAQMLKLTRQSARGSIIGVGSTRTNVDHVVQLKIGSHWNPSFEINIQAYVMSKQLTTKIPSKAVTVTHWPHLEGLNLADPDYFQPGSIDLLLGVKEYAQIVQPTLIKGPPGSPCAQETNLGWILFGEIDNNRENESFLVLHHQVHIDHMLKSLWEIDNDKKRILTKEEKLCETIYESTHTRNSEGRYLVRLPFNTKNPISTEGNTKEIARKRLLQLERRFKKETKLKEDYTKVMQEYIKANYMEEISKNEINERKSVYLPHRAVVHADRETSKTRVVFDASAKGSNCVSLNDELLVGPQLQEDLRNILMRSRLHRVCYASDI

Summary

EMBL
ODYU01002449    SOQ39955.1    JTDY01001518    KOB73672.1    RSAL01000327    RVE42512.1    + More
JTDY01000554    KOB76692.1    KQ461175    KPJ07794.1    ODYU01008608    SOQ52337.1    KQ458473    KPJ05885.1    KQ460036    KPJ18393.1    JTDY01001325    KOB74192.1    GAMC01011599    GAMC01011595    JAB94960.1    LBMM01008324    KMQ88972.1    ABLF02008594    LNIX01000069    OXA36894.1    LNIX01000012    OXA48073.1    LNIX01000026    OXA42254.1    LNIX01000007    OXA51795.1    GAMC01003146    JAC03410.1    LNIX01000016    OXA46198.1    LNIX01000005    OXA54553.1    OXA54559.1    ABLF02004142    LBMM01011423    KMQ86851.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    LBMM01009210    KMQ88303.1    GGMR01017890    MBY30509.1    LBMM01009331    KMQ88201.1    AJWK01000239    AJWK01000240    KQ977557    KYN02013.1    LBMM01008464    KMQ88855.1    LBMM01011051    KMQ87060.1    GAKP01007887    JAC51065.1    LBMM01008872    KMQ88568.1    GALX01004947    JAB63519.1    KQ977438    KYN02826.1    LBMM01005112    KMQ91804.1    HACL01000129    CFW94423.1    ODYU01008829    SOQ52773.1    QOIP01000004    RLU24048.1    LBMM01007859    KMQ89359.1    LBMM01015575    KMQ84755.1    KQ981026    KYN10209.1    LNIX01000018    OXA45284.1    NWSH01001201    PCG72150.1    LBMM01010417    KMQ87475.1    QOIP01000009    RLU19024.1    LBMM01012568    KMQ86144.1    ABLF02041863    ABLF02035780    LNIX01000063    OXA37200.1    LBMM01010405    KMQ87487.1    LBMM01012238    KMQ86334.1    LBMM01011781    KMQ86634.1    LNIX01000036    OXA39969.1    JTDY01002583    KOB71156.1    LBMM01011810    KMQ86610.1    GEZM01078370    GEZM01078366    GEZM01078363    JAV62757.1    GGMS01000724    MBY69927.1    GGMS01001896    MBY71099.1    GGMR01014230    MBY26849.1    GGMR01017408    MBY30027.1    LNIX01000044    OXA38660.1    OXA51382.1    ABLF02006304    ABLF02036268    GALX01002328    JAB66138.1    LNIX01000003    OXA58579.1    LNIX01000001    OXA61293.1    LBMM01013154    KMQ85784.1    ABLF02030854    ABLF02067347    GEHC01000877    JAV46768.1    LNIX01000002    OXA60848.1    NWSH01000070    PCG79985.1    KZ149989    PZC75621.1    JXUM01113346    KQ565681    KXJ70776.1    ABLF02008032    ABLF02035293    ABLF02060940    LBMM01016259    KMQ84489.1    LBMM01009284    KMQ88248.1    GEHC01000865    JAV46780.1    LBMM01009202    KMQ88311.1    OXA53452.1    LBMM01016077    KMQ84566.1    AJVK01036816    LBMM01011283    KMQ86917.1    GEZM01060253    JAV71158.1    ABLF02023723    OXA59522.1    GEZM01060254    JAV71154.1    DNYX01000039    HBK82233.1    KQ977080    KYN05933.1    LBMM01009888    KMQ87813.1    GGMR01002421    MBY15040.1    GGMR01002219    MBY14838.1    LBMM01011516    KMQ86784.1    LBMM01011492    KMQ86800.1    LBMM01012708    KMQ86040.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    KZ150008    PZC75149.1    LBMM01008962    KMQ88503.1   
Pfam
PF05585   DUF1758        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF00008   EGF
PF18701   DUF5641
PF17921   Integrase_H2C2
PF00435   Spectrin
PF15410   PH_9
PF00665   rve
PF00078   RVT_1
PF02145   Rap_GAP
PF00230   MIP
PF12259   Baculo_F
PF13843   DDE_Tnp_1_7
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR000253   FHA_dom       
IPR000742   EGF-like_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR013032   EGF-like_CS       
IPR005312   DUF1759       
IPR000033   LDLR_classB_rpt       
IPR040676   DUF5641       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR011993   PH-like_dom_sf       
IPR041681   PH_9       
IPR002017   Spectrin_repeat       
IPR018159   Spectrin/alpha-actinin       
IPR001995   Peptidase_A2_cat       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR029526   PGBD       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF111347   SSF111347       
SSF81338   SSF81338       

Ontologies

Topology

Length:
415
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00151
Exp number, first 60 AAs:
0.00022
Total prob of N-in:
0.05426
outside
1  -  415
 
 

Population Genetic Test Statistics

Pi
415.575072
Theta
232.698516
Tajima's D
2.437217
CLR
0.001778
CSRT
0.938203089845508
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号