SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10836
Annotation
THAP_domain-containing_protein_9?_partial_[Camponotus_floridanus]
Location in the cell
Nuclear   Reliability : 3.375
 

Sequence

CDS
ATGTGGATAAATGCGACAGGAAGGGGTCCAAGCTGGTTCCCAACAAAAAATCACACCATATGCTCGTCCCACTTTGAGCCAAAGTGCTTTCAACCATTGAAGAAAGTTCGTCGGCTCTTCGAATGGTCGGTCCCAACATTGAAGTTGCGTATGGTATTGATGAATTATATGGAACCTTCCACATCCAAAGTGTGCTTTTATTCTGAATTGGATAAAAAGGATCCTAATTTGACGGTTGCTTTAAAACTTCCAACCGGAACCGAATCACAAAATCTCACTTGTGAAAAAAACGATAATTCGGAAAATACTGCTCCAACGTCTACAATATATGGTATCGATACAAACTTTAATGCTCGACAAAATAGCATTTTGGAACAAGAAAATCTGGAAAAAAATGATCTCATCGAAACACCTAGAAAGCGTAAATTACGCCAATTGATTTTGGTACAAGACAGTTTCATAAAAACACAAAAAATGCAAATCAGAAGGCTTCAAAAGAAAACCAGCCGTTATCAGAAAAAAATTGCTAATTTAAAGGACATTTTGAAAAACCTTAATGAAAAAAACTTCATTAGTGCTGATCACGTTACGCAATTAGAAAACATTGGAGTAACCGACCTTATCCAGCGTTATGAAAGAAATGTTTCATCGGGTCAAAGTACTAACCAGAAATATCCGCCTGCTTTAAGAATTTTTGCCACTACTCTTCACTTTTATTCGCCAAAGGCGTACGCGTATGTAAGAAAAAAATTCCAAACAGCTTTGCCTCATATTCGAACCATAAAAAAGTGGTACCAATCTATCGATGCTCAGCCTGGATTCACGCAAGAATCATTAAAAGCGATAAAACTTAAAACTGCCTGCACTAAACACAAATTGTTGTGTAATTTAGTTTTAGATGAAATGGCAATCAGACAGCATGTAGAGTGGGATGGAAAACAAATGCACGGGTATGTTGATATTTCTAATTCTGCAGAACAAGGGGATTGTTTACCCGAAGCCAAAGAAGTTCTTGTATTTTTAGTTACCGCAATTAATGGGGCTTGGAAAATACCAGTCGGGTATTTTCTCATTGACGGTGTCACAGGAGAACAACGGTCTAATCTTGTCAGACAATGTTTGGAATTATTAGAAGATACAGGTATTCAAGTTACCTCGATGACTTTTGACGGCTGTCCAGCCAATATCACCATGGCTAAGAAACTCGGATGTTCTTTTGAAGTTGAAAACTTAAAATCATATTTTGAGCACCCCGTTACTCGTCAACCTGTACATATTTTTCTCGATCCATGCCACATGCTGAAGCTATTGAGAAATGCTTTTGAATCATATGGATGTTTCATGGATGCTTCAAATAGGTGTATAAAATGGAGTCATCTAAAAAATCTGTATGACATTCAGGATAAAGAAAAACTGCACTTAGCAAATAAATTACGAAAAAGTCATATCTTTTTCAAGAACCAAAAAATGAAAGTTCGCTTAGCTTCGCAATTATTTAGCAACAGTGTTGCAGATGCCCTGAATTTTTGTTGTGAACTTCAAATCGCTGGTTTTGATGATGTAGAAGGCACTGTGGAATATCTAAAAACTATCAACAACTTGTTCGATGTGTTAAATTCAAGGCATATGGCCCAACTCCATTATAAAAAACCAGTTTGCCCAGGCAACAAAGACAAGGTATTTGAAACTTTAGAAAAGGCGAAACGGTGTCTAACATCTATAAAGCTTTCAGATGGTACAAAAGCTATCATTACACCCAGAAAAACCGGTTTTATTGGTTTATTAGTGTGCATAGAAAGCCTCAAGGCCTTGTATATACAACTAATTGAAAAGGACCAAAAACTTAAGTACATTCCGGCTTACAAAATCAGCCAAGATCATTTAGAGCTTATGTTTGGACATATACGGTCACATGGTGGATGCAGCACCAACCCAACGGCGCGACAGTTTCAAGCAATATATAAAAAGCTCTTGGTAAAGTCGGAGCTTAGAGATGTAGACCAGGGAAACTGTATAGCTCTTGAGGAGGTTTCTTTTTTGTCGTGCTCTTCAGCTGTCCAAAATATAAATCTGACAATCGAACCATGTAAGTTACACGAAGGTAATGACGAAGACGAGATGAGTTTATTATATGAACAAGCCGTATTTGATGAGGAAATCAGTATACTTGTACAAGATGTCACAGAATTTAGTAGCCAGGTATGA
Protein
MWINATGRGPSWFPTKNHTICSSHFEPKCFQPLKKVRRLFEWSVPTLKLRMVLMNYMEPSTSKVCFYSELDKKDPNLTVALKLPTGTESQNLTCEKNDNSENTAPTSTIYGIDTNFNARQNSILEQENLEKNDLIETPRKRKLRQLILVQDSFIKTQKMQIRRLQKKTSRYQKKIANLKDILKNLNEKNFISADHVTQLENIGVTDLIQRYERNVSSGQSTNQKYPPALRIFATTLHFYSPKAYAYVRKKFQTALPHIRTIKKWYQSIDAQPGFTQESLKAIKLKTACTKHKLLCNLVLDEMAIRQHVEWDGKQMHGYVDISNSAEQGDCLPEAKEVLVFLVTAINGAWKIPVGYFLIDGVTGEQRSNLVRQCLELLEDTGIQVTSMTFDGCPANITMAKKLGCSFEVENLKSYFEHPVTRQPVHIFLDPCHMLKLLRNAFESYGCFMDASNRCIKWSHLKNLYDIQDKEKLHLANKLRKSHIFFKNQKMKVRLASQLFSNSVADALNFCCELQIAGFDDVEGTVEYLKTINNLFDVLNSRHMAQLHYKKPVCPGNKDKVFETLEKAKRCLTSIKLSDGTKAIITPRKTGFIGLLVCIESLKALYIQLIEKDQKLKYIPAYKISQDHLELMFGHIRSHGGCSTNPTARQFQAIYKKLLVKSELRDVDQGNCIALEEVSFLSCSSAVQNINLTIEPCKLHEGNDEDEMSLLYEQAVFDEEISILVQDVTEFSSQV

Summary

EMBL
ODYU01003321    SOQ41917.1    GEZM01099609    JAV53257.1    GEZM01077470    JAV63295.1    + More
GEZM01099613    GEZM01099610    GEZM01099604    GEZM01099599    JAV53268.1    ABLF02011460    ABLF02033413    GEZM01099608    GEZM01099605    JAV53264.1    GL441823    EFN64217.1    ABLF02007004    ABLF02007005    ABLF02038040    ABLF02065516    ABLF02008523    GEZM01031190    GEZM01031189    GEZM01031180    JAV84979.1    GEZM01031195    GEZM01031187    GEZM01031186    GEZM01031184    GEZM01031182    GEZM01031181    JAV84992.1    RSAL01000057    RVE49849.1    NWSH01000621    PCG75234.1    KQ977321    KYN03587.1    KQ977365    KYN03296.1    ABLF02016100    ABLF02009662    NWSH01001223    PCG72048.1    GGMR01014547    MBY27166.1    ABLF02016252    GGMR01004395    MBY17014.1    ABLF02011489    ABLF02031649    ABLF02031650    GFAC01001507    JAT97681.1    ABLF02016193    HAAD01001124    CDG67356.1    ABLF02013367    ABLF02015440    ABLF02057211    ABLF02033156    HADY01024360    SBP62845.1    HAEJ01000494    SBS40951.1    AERX01031390    ABLF02008676    ABLF02008677    ABLF02015299    ABLF02042324    ABLF02062307    ABLF02067566    ABLF02015114    GGMR01015195    MBY27814.1    GEZM01060283    JAV71121.1    HAEA01002407    SBQ30887.1    ABLF02011974    ABLF02057541    ABLF02019247    ABLF02019254    ABLF02032544    ABLF02032554    ABLF02056709    ABLF02067302    GEZM01007800    JAV94909.1    RSAL01000093    RVE47898.1    GEZM01007799    JAV94911.1    ABLF02010172    GEZM01073324    JAV65152.1    RJVU01019282    ROL50904.1    GEZM01073325    JAV65151.1    GEZM01095994    JAV55218.1    ABLF02005824    ABLF02005825    ABLF02005826    ABLF02005827    ABLF02050516    ABLF02053731    ABLF02041912    AJVK01060859    GGMR01003865    MBY16484.1    ABLF02008986    ABLF02008987    KQ979155    KYN22412.1    ABLF02014223    ABLF02014224   
Pfam
PF12017   Tnp_P_element        + More
PF05485   THAP
PF03564   DUF1759
Interpro
IPR006612   THAP_Znf        + More
IPR021896   Transposase_37       
IPR038441   THAP_Znf_sf       
IPR001315   CARD       
IPR005312   DUF1759       
Gene 3D

Ontologies

Topology

Length:
734
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14655
Exp number, first 60 AAs:
0.00114
Total prob of N-in:
0.00127
outside
1  -  734
 
 

Population Genetic Test Statistics

Pi
115.501701
Theta
127.824373
Tajima's D
-0.654085
CLR
0.22232
CSRT
0.208839558022099
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号