SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10825
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.157 Mitochondrial   Reliability : 1.286
 

Sequence

CDS
ATGGTATGTAGTGCGTGTGCACGTCTCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MVCSACARLSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

Cofactor
FAD
Similarity
Belongs to the FBPase class 1 family.
Belongs to the GMC oxidoreductase family.
EMBL
AB090825    BAC57926.1    AB126050    BAD86650.1    LBMM01009501    KMQ88083.1    + More
LBMM01005707    KMQ91279.1    LBMM01016102    KMQ84557.1    QOIP01000014    RLU15083.1    LBMM01006538    KMQ90523.1    QOIP01000009    RLU18544.1    KZ149950    PZC76665.1    AB078935    BAC06462.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    KZ150386    PZC71062.1    KZ150308    PZC71477.1    AB078930    BAC06454.1    AB078931    BAC06456.1    RSAL01000006    RVE54258.1    RSAL01003504    RVE40273.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    RSAL01000109    RVE47213.1    KZ149922    PZC77700.1    RSAL01000014    RVE53298.1    LBMM01006909    KMQ90209.1    ODYU01006757    SOQ48893.1    LBMM01003679    KMQ93242.1    LBMM01006022    KMQ91008.1    RSAL01000481    RVE41577.1    LBMM01001564    KMQ96079.1    ODYU01009945    SOQ54696.1    LBMM01006996    KMQ90129.1    ODYU01006342    SOQ48109.1    ODYU01005282    SOQ45985.1    QOIP01000002    RLU25407.1    LBMM01006657    KMQ90417.1    LBMM01004272    KMQ92618.1    LBMM01005634    KMQ91349.1    LBMM01006671    KMQ90407.1    QOIP01000012    RLU16027.1    LBMM01003452    KMQ93523.1    LBMM01019838    KMQ83439.1    LBMM01019839    KMQ83438.1    QOIP01000003    RLU25053.1    QOIP01000010    RLU18098.1    LBMM01006662    KMQ90413.1    GGMR01010769    MBY23388.1    ABLF02017307    LBMM01004152    KMQ92762.1    GFXV01002090    MBW13895.1    LBMM01008349    KMQ88951.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00316   FBPase
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF00732   GMC_oxred_N
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR033391   FBPase_N       
IPR000146   FBPase_class-1       
IPR028343   FBPtase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF51905   SSF51905       
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
184
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00625000000000001
Exp number, first 60 AAs:
1e-05
Total prob of N-in:
0.14475
outside
1  -  184
 
 

Population Genetic Test Statistics

Pi
65.34972
Theta
63.006054
Tajima's D
0.528922
CLR
54.106092
CSRT
0.525823708814559
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号