SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10809
Pre Gene Modal
BGIBMGA008440
Annotation
aldehyde_oxidase_2_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.531
 

Sequence

CDS
ATGATTGTAATAGATTGTGGTGATCATACTTGGTATAAATGTTATACTTTAAGTGATGTTTTTAGTGTCATAGAAAAGAGTACGGATTATAAATTGATTGCTGGAAATACAGGACAAGGAGTATATCACGTCCTGGATTATCCTAAGCTTGTCATTGATATTTCTAACGTAACAGATATAAGAGAATATGTCGTGGATGTTAATCTAACACTTGGTGCTGGAATGACTTTAACAGAAATGATGGAATTATTCCTTAAGCTTTCTGATGACAACGTAGACTTTAACTACTTGAAGGAGTTTCATGATCACATGGACTTGGTCGCTCATTTGCCAGTAAGGAATATCGGAACCATCGGTGGTAACTTGTACTTGAAACACTGCAACAAGGAATTCCAGTCAGATTTATTTTTGCTATTCGAGACTGTTGGAGCTATGATTACAATAGCCGAAAAAATGGACAAAATATCGACAATGTACCTTACAGATTTCCTCGAAACAGAAATGAAGGGAAAAATAATAATCAATGTGATGTTACCCCCCTTATCAAGTTCTACGAAGATCAAAACGTACAAGATAATGCCGAGATCACAAAACGCACACGCGATAGTCAACGCAGGATTTCTTTGGAAATTCAAACAAAATTCAAGTATACTGGAAAAAGCGACAATAGTATACGGTGGAATATCACCAAACTTTATTCATGCGTCAAAAACCGAGAGTATTTTATCAAACACAGATCCGTTCTCCGATGAAACTATACAGGAGGCATTGAAGACTTTATATGATGAAGTCAAGCCTGAAAACTCTCCAACAGAGCCATCTGCTTCTTATAGAAGAATGTTGGCTGTTTCTTTATATTACAAAGCATTAATAAGTCAATGTCCCGATGATCGAATCAACCCGAAGTATAAATCTGGCGGTAATGTTATTAAGCGGAATACGTCCAAAGGCACACAAACTTTCGAGACAGATGAAAATCTTTGGCCTTTAAATCAACCTGTGATGAAATTAGAAGCTTTAGCACAATGCAGCGGGGAAGCTACATTTGCCAATGATTTAAAAGGAGAATCAGACGAAGTATATGCTGCTTTTGTAACTGCTGACGTCAAACCTGGTAGTATTATTAGTGGCTTTGATACTACAGAAGCTTTTAAAATAGCAGGAGTTTCAGGATTTTATACCGCACAGGACATTCCCGGAAATAATTCATTTACACCAACCAACGCACCTTTGATTTTAGTGAATGAAGAAATATTGTGTTCTAAACAGGTCAAATACTATGGCGAACCAGCAGCGATAATAGTAGCGGATAGAGAAAAAACGGCCATTAAGGCTGCTAAACTAATATCGATAAAATATGAATCCATCAATAAAAATAAACCTGTACTAACAATTGATGACGCATTGAAAAGTCCAGATAAAGATACACGAATAACCAAAAACAATGTTATATATCCCGTCGAAGTTGGTCATGATGTGAAATGTATTATTTATGGGGAATTAAATATTGAAACACAGCATCACTTTTATATGGAGCCACAAACTTGCGTCGCAAAGAAAACCGAAGATGGCTTAGAAATATATTCTTCTACGCAATGGCTGGATTTGGCTAATATGGCTGTTGCACAATGTCTAAGCGTGCCCATAAATAGTGTGAACGTGATCATTAGAAGAGTTGGTGGTAGTTATGGAGGTAAAATTACAAGATCTAGTCAGATAGCATGTGGAGCAGCTCTTATTACGCATCTAACTGGAAAAACATGCAGGTTTATTCTGCCTTTGCAACAAAATATGGGAATTATTGGTAAACGGCTCCCAACAAAATGTAATTTCGAAGTGGGTGTTGACAATAACGGTGAAATACAATACCTTAAAAATATATTCTATCAAGACAATGGATGTGCACCGAATGAAACGATTAGTCCAGTGACTGCAGCCCATTTTGTTGGGAACTGCTATGATAGTCGAAGATGGTACGTCGAAGCTAATAGCGCAGCAACTGATAGCCCATCTAACACTTGGTGTAGAGCTCCTTCTTCAACAGAAGCAATAGCAATGTGTGAATACATAATGGAAAAGGTAGCATATCATCTGAATAAAGATCCTTTAGAAGTGAGACTAACTAATATGATGCAAGTCACAAATCCTATTCCACAATTAATTGACCAACTAAAAAGAGACTCGGACTACGACCAAAGAATAATTGATGTGCAAAATTACAATAAGCAGAATAGATGGAGAAAGCGAGCTTTGAAACTCTTGCCAATGACTTATGATGTCTTTTATTTCGGGTCATATAATTCCGTTGTATCAGTTTATCACGCAGATGGGTCAGTTGTGATAATACATGGTGGAGTTGAAATGGGTCAAGGTTTAAACACAAAAGTAGCTCAAGTATGTGCATACATTTTTGGTATTCCCCTCAACAAAATTAGCGTAAAACCTAGTACAAGCTTTACGAGTCCAAACGCAATGACCACAGGTGGTAGTATTGGTAGTGAATGTGTGTCTTTTGCAACAATGAAAGCCTGCCAGATAATAATGGATCGCCTCAAACCAATCAAAGAAGAATTGAATGATCCAAAATGGGAGGATATTATTAAAAAAGCTTTCAATAACGATATAGATTTGCAAGCGTCATATATGTATTCAAATAAAGATGGCTTAAAGCCATATGATGTGTATGGTGTAGTTGTGATGGAGGTTGAAGTTGATATTTTAACTGGAAACCATGATGTGCTGAGAGTTGATTTACTGGAAGATACTGGCAGAAGTATGAGTCCGGGAATTGACGTTGGACAGATAGAGGGTGCGTTCATCATGGGTCTCGGCTATTGGACATCGGAAAAAGTGATTTATGATCAGGAAACTGGAAAGCTCCTAACGGATCGTACTTGGACGTACAAGCCTCCTGGTCTTAAGGATATACCGGCAGATTTCCGAATATATTTCAGGAGGAATTCCAACAACCCTACCGGAGTACTACAATCTAAAGCAACTGGCGAACCGGCATTCTCTCTAGCTGCAGTAATAACTCATGCTATACGGGATGCAGTTAGGGCTGCTAGACTTGACGCTGCCTACGAAGACCAATGGATTGATATTCCTAATCCCTGCACGGTGGAAAACATATTTATGGCTGTCGGACACAGATTAGACCAGTTCGTGTTGAAGTGA
Protein
MIVIDCGDHTWYKCYTLSDVFSVIEKSTDYKLIAGNTGQGVYHVLDYPKLVIDISNVTDIREYVVDVNLTLGAGMTLTEMMELFLKLSDDNVDFNYLKEFHDHMDLVAHLPVRNIGTIGGNLYLKHCNKEFQSDLFLLFETVGAMITIAEKMDKISTMYLTDFLETEMKGKIIINVMLPPLSSSTKIKTYKIMPRSQNAHAIVNAGFLWKFKQNSSILEKATIVYGGISPNFIHASKTESILSNTDPFSDETIQEALKTLYDEVKPENSPTEPSASYRRMLAVSLYYKALISQCPDDRINPKYKSGGNVIKRNTSKGTQTFETDENLWPLNQPVMKLEALAQCSGEATFANDLKGESDEVYAAFVTADVKPGSIISGFDTTEAFKIAGVSGFYTAQDIPGNNSFTPTNAPLILVNEEILCSKQVKYYGEPAAIIVADREKTAIKAAKLISIKYESINKNKPVLTIDDALKSPDKDTRITKNNVIYPVEVGHDVKCIIYGELNIETQHHFYMEPQTCVAKKTEDGLEIYSSTQWLDLANMAVAQCLSVPINSVNVIIRRVGGSYGGKITRSSQIACGAALITHLTGKTCRFILPLQQNMGIIGKRLPTKCNFEVGVDNNGEIQYLKNIFYQDNGCAPNETISPVTAAHFVGNCYDSRRWYVEANSAATDSPSNTWCRAPSSTEAIAMCEYIMEKVAYHLNKDPLEVRLTNMMQVTNPIPQLIDQLKRDSDYDQRIIDVQNYNKQNRWRKRALKLLPMTYDVFYFGSYNSVVSVYHADGSVVIIHGGVEMGQGLNTKVAQVCAYIFGIPLNKISVKPSTSFTSPNAMTTGGSIGSECVSFATMKACQIIMDRLKPIKEELNDPKWEDIIKKAFNNDIDLQASYMYSNKDGLKPYDVYGVVVMEVEVDILTGNHDVLRVDLLEDTGRSMSPGIDVGQIEGAFIMGLGYWTSEKVIYDQETGKLLTDRTWTYKPPGLKDIPADFRIYFRRNSNNPTGVLQSKATGEPAFSLAAVITHAIRDAVRAARLDAAYEDQWIDIPNPCTVENIFMAVGHRLDQFVLK

Summary

Cofactor
FAD
Mo-molybdopterin
[2Fe-2S] cluster
Similarity
Belongs to the UDP-glycosyltransferase family.
EMBL
EU073424    ABW71272.1    LC017753    BAR64767.1    RSAL01000229    RVE43893.1    + More
KF960795    AII21997.1    NWSH01000413    PCG76558.1    KY595779    ARS46833.1    KF960794    AII21996.1    PCG76559.1    AGBW02008082    OWR54176.1    ODYU01002537    SOQ40155.1    BABH01001657    BABH01001658    BABH01001659    BABH01001660    PCG76561.1    EU073423    ABW71271.1    KQ461196    KPJ06623.1    ODYU01001109    SOQ36868.1    LC017752    BAR64766.1    KY595778    ARS46832.1    PCG76560.1    KQ459606    KPI90909.1    ODYU01001878    SOQ38698.1    ODYU01004253    SOQ43930.1    KPI90950.1    KP899546    AKQ06145.1    LC017757    BAR64771.1    BABH01001568    BABH01001569    BABH01001570    BABH01001571    BABH01001572    BABH01001573    JTDY01000607    KOB76483.1    DS232324    EDS40041.1    BABH01001558    KQ459193    KPJ03063.1    KQ435826    KOX72014.1    LC017754    BAR64768.1    NWSH01002143    PCG69059.1    CVRI01000075    CRL08602.1    GFDL01008214    JAV26831.1    GFDL01008505    JAV26540.1    KY595781    ARS46835.1    GL441193    EFN65044.1    AXCN02000553    KPJ06614.1    CH477659    EAT37664.1    EDS40039.1    KP899547    AKQ06146.1    KC952900    AGQ43599.1    GGFJ01000772    MBW49913.1    AGBW02010767    OWR47879.1    GGFJ01001064    MBW50205.1    GGFJ01001065    MBW50206.1    KQ414670    KOC64413.1    ADMH02001746    ETN61221.1    GGFM01006571    MBW27322.1    GGFJ01000687    MBW49828.1    GFDL01004496    JAV30549.1    NEVH01007404    PNF35793.1    KPI90999.1    GEDC01004862    JAS32436.1    GGFL01002295    MBW66473.1    GGFJ01000686    MBW49827.1    KY643683    AQY62686.1    AXCN02000554    APCN01000032    EDS40053.1    ETN61219.1    GGFL01002475    MBW66653.1    ATLV01024093    KE525349    KFB50588.1    KPI91000.1    GBBI01004413    JAC14299.1    KQ459674    KPJ20482.1    NWSH01007172    PCG63055.1    KQ434912    KZC11368.1    RSAL01000123    RVE46648.1    ODYU01000376    SOQ35055.1    UFQS01000745    UFQT01000745    SSX06553.1    SSX26900.1    GANO01002236    JAB57635.1    JXUM01014357    JXUM01014358    JXUM01014359    KQ560401    KXJ82608.1    KQ981281    KYN43332.1    AAAB01008960    EAA11584.4    KQ769812    OAD52839.1    GL888413    EGI61333.1    DS232859    EDS26176.1    EAT37662.1    APCN01000031    KPI90997.1    GFDF01002797    JAV11287.1    KQ982557    KYQ55014.1    KQ460326    KPJ15694.1    GFDF01002843    JAV11241.1    KQ976546    KYM80948.1   
Pfam
PF00941   FAD_binding_5        + More
PF01799   Fer2_2
PF01315   Ald_Xan_dh_C
PF03450   CO_deh_flav_C
PF00111   Fer2
PF02738   Ald_Xan_dh_C2
PF01130   CD36
PF00201   UDPGT
PF07651   ANTH
Interpro
IPR016208   Ald_Oxase/xanthine_DH        + More
IPR000674   Ald_Oxase/Xan_DH_a/b       
IPR002888   2Fe-2S-bd       
IPR036884   2Fe-2S-bd_dom_sf       
IPR008274   AldOxase/xan_DH_Mopterin-bd       
IPR005107   CO_DH_flav_C       
IPR036318   FAD-bd_PCMH-like_sf       
IPR001041   2Fe-2S_ferredoxin-type       
IPR036010   2Fe-2S_ferredoxin-like_sf       
IPR036683   CO_DH_flav_C_dom_sf       
IPR036856   Ald_Oxase/Xan_DH_a/b_sf       
IPR006058   2Fe2S_fd_BS       
IPR016166   FAD-bd_PCMH       
IPR037165   AldOxase/xan_DH_Mopterin-bd_sf       
IPR002346   Mopterin_DH_FAD-bd       
IPR016169   FAD-bd_PCMH_sub2       
IPR012675   Beta-grasp_dom_sf       
IPR002159   CD36_fam       
IPR006621   Nose-resist-to-fluoxetine_N       
IPR002213   UDP_glucos_trans       
IPR035595   UDP_glycos_trans_CS       
IPR013809   ENTH       
IPR008942   ENTH_VHS       
IPR011417   ANTH_dom       
IPR014712   Clathrin_AP_dom2       
SUPFAM
SSF54665   SSF54665        + More
SSF54292   SSF54292       
SSF55447   SSF55447       
SSF56003   SSF56003       
SSF56176   SSF56176       
SSF47741   SSF47741       
SSF48464   SSF48464       
PDB
3UNI     E-value=2.06157e-102,     Score=955

Ontologies

Topology

Length:
1058
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0949400000000001
Exp number, first 60 AAs:
0.00046
Total prob of N-in:
0.00428
outside
1  -  1058
 
 

Population Genetic Test Statistics

Pi
162.440639
Theta
171.421685
Tajima's D
-0.64475
CLR
27.63551
CSRT
0.206739663016849
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号