SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10808
Pre Gene Modal
BGIBMGA008439
Annotation
aldehyde_oxidase_1_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.199 Nuclear   Reliability : 1.021 PlasmaMembrane   Reliability : 1.208
 

Sequence

CDS
ATGGACAAAATAAAGTTAAAAATTAACGATAAACATTACACTGTGGACGGCAAGTTCGGTCCGGATGTGTCGCTCAACGAGTTCATCAGGAATGTGGCAGAGCTCCGGGGTACGAAGGCGATGTGTCACGAGGGCGGCTGTGGAGCCTGCGTCGTCGCCGTCAGAGCATCTCTACCGCCCAACAACGAAATGAAGACATTCGCCGTTAATTCGTGCTTAGTGTCAATTTTATCGTGTCACGAGTGGGAAGTGATCACTGTGGAAGGAATAGGTAACAAATCAATTGGTTACCATGAAATTCAAACTAGACTGGCTAATTTCAATGGTACACAATGTGGGTTTTGTACACCCGGATGGGTCATGAATATGTATAGTATATACCAATCGAAAAACAAAAAATTAAGCCAAAAACAAATTGAAAACTCTTTTGCCGGTAACATTTGTCGATGTACAGGCTACCGACCAATTGCAGATGCTTTTAAATCCTTCGCAAAAGATGCTGATCAAAAATTATTGAACAAAATCTGCGACTTAGAAGATCTGACCGTATTCAAAGCTTGTGGTTTTAGTTGTAAAAGCAGTTGCAAGAGAACTGGATGTAAAAATAAACACGACGAAGGAAACGTGGAAGAAGACTTTGCTGTAATTAATGATAGTAAAACAATTGAAATTGACTGTGGTACTCACAAATGGTTTAAAACTTATAAATTGGATGATGTTTTCAAAGTGATGGCCCACGGTGATTACAAATTGATTGCCGGTAATACCGGACAAGGTGTTTACCACATCAAAGGTTACCCAACGAATGTCATTGATATTTTTAATGTTAGCGAATTGAAGAGCTACGTTGTGGATGTCAATTTGATTATTGGTGCCGGAACCTCCTTGGCGGATATGATGGAATTGTTTCTAAAGCTCTCCAGCTCCAACGAAGAATTCAGATATTTGAAACACTTTCATGATCATATGGATTTGGTGGCTCATATTCCAGTTCGTAATATCGGAACCATCGCCGGTAATTTAATGCTGAAACACGACAACAGAGAATTTCAATCGGATATATTTTTACTTTTTGAAACTGTACAGGCAATGATCACTATCGCCTCGAGCGCAACAAAAGAAATTACGGTCACCCTCCCCGAATTCCTGGAAATGGAAATGAATGGTAAAATAGTACTAAACGTTATACTGCCACCTTTATCGAATAAATGTAAAATCAAAACGTTCAAGATAATGCCCAGATCGCAAAACGCTCATGCAGTTGTTAACGCTGGATTTCTATTTCACTTCAAACAATCAAAAAACGTACTGCAAAATGTATCTATTGTCTACGGAGGTATTTCGCCAGATTTCATCCATGCTTCGAAAACAGAGGCATTACTAATCAACCAAAATCCCTTTACCGATAAAACATTACAAATGGCATTGAAATCTTTGAATGAGGAGTTAAAACCTAAAGAAATGCCCCCTGAGCCGTCTGCGGCGTATAGAAAAATGTTAGCATTGGCTTTGTATTACAAGGCAATCTTAAGTTTAAGCTCTGAATCAATAAATCCAATATACAAAAGTGGCGGGGAAGTTATAAAACGAAGTGTTTCACACGGCACTCAATCTTTTGAAACAGATAAAGAAGTGTGGCCACTGAATCAGCCGGTACCTAAATTGGAAGTACTAGTACAATGCAGTGGTGAAGCGGTGTTTGCAAATGATTTACCTAAACAATCGAGTGAAGTTTTTGGTGCATTCGTTACAGCAGACACAACGCCCGGAAGTATTATTAAGGATTTTGATACCGAAGAAGCTTTCAAAATACCTGGAGTTATTGCTTTTTACACAGCCAAAAACATACCAGGCATTAACTCCTTTGTACCAATATCTATTCCATTTGCTATAGAAAACGAAGAATTACTATGCGAAAAAACAGTTAAATATTACGGTCAACCTGCAGCCATAATTGTAGCAGATAGAGAAAAAACAGCCAACAAAGCTGCTGGACTTGTCAAAATCAAATATGATTTTGTCAACAAAGAAAAACCCTTACTGACCATTGACGAAGTCCTCAATTCCCCCAAACGGAAAACTCTCGTAAGGCAAGATATGACAGTTCAGCCAACTGACTCAGGATCCGATATAAGCACTGTAATTGAAGGCTCTATGAAAATTCATGCACAATACCATTATACGATGGAAACGCAAACATCTGTGGCAACTCCTACTGAGGATGGCTTAGAGATTTACTCTTCAACGCAATGGCTCGATTTAACTAACATAGCAATCGCAAAATGTTTGGATATGCCCGTTAATAGTATCAACATCATTGTTCGTCGATTAGGCGGAGGGTACGGAAGTAAAATAACTCGCGCCAGTCAAATAGCTTGCGCGGCGGCCTTGGTCACCCGTTTCCTTGGGCGTACTTGTAGATTTATCTTACCGCTACAAACTAATATGAAAGCTATAGGCAAACGTATACCTACCAATTGTGAGTTTGAGATTGGCGTAAACAAAGCTGGTAGAATTCAAAATCTCAAAAATACATTTTATCAAGACGGTGGATGTTCCTTTAATGAAGTCCTCACCCCTCTAACAGTTAAACATTTCCAGAACTGTTACGATTCTAAGCGTTGGTTTATACAAAGCAACAGTGTGAAAACTGACAACGCTTCTAACACCTGGTGCAGGTCGCCATGCAGTACTGAAGGAATAGCAATGATAGAACAAATTATGGAAATGATCGCATTTTACACGAAAAACATTCCTTTGAATGTCCGATTGCAAAATATGTCTCAAGATAATAATCCTCTACCAGAGATGATAGATCAATTAATAATAGATGCAAATTACGATGAAAGAGTTAAAGAAGTTAAAAAATTCAATAATCAAAATCGTTGGAGGAAACGTGGAATAAATTTGCTTCCTCTGTCCTCTAATATAACATACTTTGGCTTATTTAACTGTATAATTTCTGTTTACCACGGTGATGGAACTGTCGTGATCACCCACGGTGGTATAGAAATGGGTCAAGGTATAAATACTAAGGCCGCCCAAGTCTGCGCTTATGCCCTAGGTATTAAATTAGAGAAAATAAGCGTAAAGCCAAGTTCTAGTTTCACTTCACCCAACAATATGGTAACCGGTGGCAGTATTGGCAGCGAATGCGTTTCATTCGCAGTCATGAAGGCGTGTAATGAATTAAACAAAAGATTAGCGCCAATAAAAGAGAAACTGAGCAATCCTAGCTGGGAAGAGCTAATTGTTGAAGCTAATACGGCTGGAATCAATTTACAAGTGGCTTCGGCTTTTTCACCTGTGACGGATGGGGTGAAACCATATGATGTTTATGCTGTTGGCATTATAGAAGTAGAAGTTGACATTTTAACCGGAAATCATGAAGTACTAAGAGTTGATATACTTGAAGATACCGGCAGGAGTTTGAGTCCTGAAATCGATATTGCACAGATCGAAGGAGGGTTTATTATGGGTTTAGGATACTGGACTTCTGAAAAACTGATGTATGACAGCGCGACCGGAAAACTGTTAACTGACCGAACATGGAATTATAAGCCACCAGGAATCAAAGACATCCCAGCAGACATGAGAATATATTTCCGGAGGAACGCAAGAAACGAATTTGGTGTTCTGCAGTCGAAAGCAACTGGCGAACCATCGTTCTGTTTGGCGATAGGTGTGACCCACGCTATCCGTGAGGCCATAAGATCGAGTCGTTTGGACGCTGGATACGAAGATAAATGGCTAGATATCGATCTGCCATTCACCGTGGAAAATATCTTCATGGCAGCCGGAAACGTAATAGAACATTTTAAATTAACGTAA
Protein
MDKIKLKINDKHYTVDGKFGPDVSLNEFIRNVAELRGTKAMCHEGGCGACVVAVRASLPPNNEMKTFAVNSCLVSILSCHEWEVITVEGIGNKSIGYHEIQTRLANFNGTQCGFCTPGWVMNMYSIYQSKNKKLSQKQIENSFAGNICRCTGYRPIADAFKSFAKDADQKLLNKICDLEDLTVFKACGFSCKSSCKRTGCKNKHDEGNVEEDFAVINDSKTIEIDCGTHKWFKTYKLDDVFKVMAHGDYKLIAGNTGQGVYHIKGYPTNVIDIFNVSELKSYVVDVNLIIGAGTSLADMMELFLKLSSSNEEFRYLKHFHDHMDLVAHIPVRNIGTIAGNLMLKHDNREFQSDIFLLFETVQAMITIASSATKEITVTLPEFLEMEMNGKIVLNVILPPLSNKCKIKTFKIMPRSQNAHAVVNAGFLFHFKQSKNVLQNVSIVYGGISPDFIHASKTEALLINQNPFTDKTLQMALKSLNEELKPKEMPPEPSAAYRKMLALALYYKAILSLSSESINPIYKSGGEVIKRSVSHGTQSFETDKEVWPLNQPVPKLEVLVQCSGEAVFANDLPKQSSEVFGAFVTADTTPGSIIKDFDTEEAFKIPGVIAFYTAKNIPGINSFVPISIPFAIENEELLCEKTVKYYGQPAAIIVADREKTANKAAGLVKIKYDFVNKEKPLLTIDEVLNSPKRKTLVRQDMTVQPTDSGSDISTVIEGSMKIHAQYHYTMETQTSVATPTEDGLEIYSSTQWLDLTNIAIAKCLDMPVNSINIIVRRLGGGYGSKITRASQIACAAALVTRFLGRTCRFILPLQTNMKAIGKRIPTNCEFEIGVNKAGRIQNLKNTFYQDGGCSFNEVLTPLTVKHFQNCYDSKRWFIQSNSVKTDNASNTWCRSPCSTEGIAMIEQIMEMIAFYTKNIPLNVRLQNMSQDNNPLPEMIDQLIIDANYDERVKEVKKFNNQNRWRKRGINLLPLSSNITYFGLFNCIISVYHGDGTVVITHGGIEMGQGINTKAAQVCAYALGIKLEKISVKPSSSFTSPNNMVTGGSIGSECVSFAVMKACNELNKRLAPIKEKLSNPSWEELIVEANTAGINLQVASAFSPVTDGVKPYDVYAVGIIEVEVDILTGNHEVLRVDILEDTGRSLSPEIDIAQIEGGFIMGLGYWTSEKLMYDSATGKLLTDRTWNYKPPGIKDIPADMRIYFRRNARNEFGVLQSKATGEPSFCLAIGVTHAIREAIRSSRLDAGYEDKWLDIDLPFTVENIFMAAGNVIEHFKLT

Summary

Cofactor
FAD
Mo-molybdopterin
[2Fe-2S] cluster
EMBL
BABH01001657    BABH01001658    BABH01001659    BABH01001660    EU073423    ABW71271.1    + More
NWSH01000413    PCG76559.1    KF960794    AII21996.1    ODYU01002537    SOQ40155.1    RSAL01000229    RVE43893.1    LC017753    BAR64767.1    KY595779    ARS46833.1    PCG76561.1    EU073424    ABW71272.1    KF960795    AII21997.1    ODYU01001109    SOQ36868.1    LC017752    BAR64766.1    PCG76558.1    AGBW02008082    OWR54176.1    KQ461196    KPJ06623.1    KY595778    ARS46832.1    KQ459606    KPI90909.1    KP899546    AKQ06145.1    ODYU01004253    SOQ43930.1    KPI90950.1    LC017757    BAR64771.1    ODYU01001878    SOQ38698.1    KQ435826    KOX72014.1    DS232324    EDS40041.1    GBBI01004413    JAC14299.1    NEVH01007404    PNF35793.1    AXCN02000553    GFDL01008214    JAV26831.1    CH477659    EAT37664.1    GFDL01008505    JAV26540.1    KQ414670    KOC64413.1    KQ434912    KZC11368.1    RSAL01000123    RVE46648.1    KQ459193    KPJ03063.1    KC952900    AGQ43599.1    LC017754    BAR64768.1    KQ769812    OAD52839.1    GEDC01004862    JAS32436.1    NWSH01007172    PCG63055.1    UFQS01000745    UFQT01000745    SSX06553.1    SSX26900.1    KQ979701    KYN19697.1    KPI90997.1    GGFJ01000772    MBW49913.1    EDS40039.1    ATLV01024093    KE525349    KFB50588.1    GL888413    EGI61333.1    GL441193    EFN65044.1    GEYN01000002    JAV02127.1    KZ288369    PBC26783.1    JR045677    AEY60027.1    ADMH02001746    ETN61219.1    KY595781    ARS46835.1    KQ982557    KYQ55014.1    GFDL01004496    JAV30549.1    KQ976546    KYM80948.1    GANO01002236    JAB57635.1    ETN61221.1    KPI90999.1    KQ971466    EFA13012.2    GGFL01002295    MBW66473.1    GGFJ01000687    MBW49828.1    GGFJ01000686    MBW49827.1    KQ981281    KYN43332.1    GDHC01015520    JAQ03109.1    EDS40053.1    KF960796    AII21998.1    APCN01000031    APCN01000032    GEYN01000003    JAV02126.1    KPJ06614.1    GDHC01013650    GDHC01001960    JAQ04979.1    JAQ16669.1    GFDF01002797    JAV11287.1    AXCN02000554    CVRI01000075    CRL08602.1    GGFM01006571    MBW27322.1    KQ459674    KPJ20482.1    GBHO01014557    GBHO01014554    GBRD01002756    JAG29047.1    JAG29050.1    JAG63065.1    ACPB03005165    AAAB01008960    EAA11584.4    NWSH01000648    PCG75033.1    KQ460326    KPJ15694.1    KP899547    AKQ06146.1    KPI91000.1    NNAY01002364    OXU21456.1    KY643683    AQY62686.1    DS232859    EDS26176.1    ACPB03000354    ACPB03000355   
Pfam
PF01799   Fer2_2        + More
PF00941   FAD_binding_5
PF02738   Ald_Xan_dh_C2
PF01315   Ald_Xan_dh_C
PF00111   Fer2
PF03450   CO_deh_flav_C
PF01130   CD36
PF07651   ANTH
Interpro
IPR006058   2Fe2S_fd_BS        + More
IPR012675   Beta-grasp_dom_sf       
IPR016166   FAD-bd_PCMH       
IPR037165   AldOxase/xan_DH_Mopterin-bd_sf       
IPR002346   Mopterin_DH_FAD-bd       
IPR036856   Ald_Oxase/Xan_DH_a/b_sf       
IPR001041   2Fe-2S_ferredoxin-type       
IPR036010   2Fe-2S_ferredoxin-like_sf       
IPR036683   CO_DH_flav_C_dom_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR036318   FAD-bd_PCMH-like_sf       
IPR036884   2Fe-2S-bd_dom_sf       
IPR008274   AldOxase/xan_DH_Mopterin-bd       
IPR005107   CO_DH_flav_C       
IPR002888   2Fe-2S-bd       
IPR016208   Ald_Oxase/xanthine_DH       
IPR000674   Ald_Oxase/Xan_DH_a/b       
IPR002159   CD36_fam       
IPR013809   ENTH       
IPR008942   ENTH_VHS       
IPR011417   ANTH_dom       
IPR014712   Clathrin_AP_dom2       
IPR006621   Nose-resist-to-fluoxetine_N       
SUPFAM
SSF47741   SSF47741        + More
SSF56176   SSF56176       
SSF56003   SSF56003       
SSF55447   SSF55447       
SSF54292   SSF54292       
SSF54665   SSF54665       
SSF48464   SSF48464       
PDB
4YTY     E-value=8.58478e-131,     Score=1201

Ontologies

Topology

Length:
1276
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.263860000000001
Exp number, first 60 AAs:
0.00954
Total prob of N-in:
0.00837
outside
1  -  1276
 
 

Population Genetic Test Statistics

Pi
247.296896
Theta
180.591255
Tajima's D
1.581418
CLR
0.132843
CSRT
0.802009899505025
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号