SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10799
Annotation
PREDICTED:_uncharacterized_protein_LOC101738890_[Bombyx_mori]
Full name
Retrovirus-related Pol polyprotein from transposon 17.6      
Location in the cell
Nuclear   Reliability : 2.36
 

Sequence

CDS
ATGCTCGACCAAAAAATCATACAACCTTCTCTATCTCCTTGGTCCTCGCCTATATGGATTGTCCCAAAAAAGACCGATGCCTCTGGTCAAAAGAAATGGCGGATTGTAATTGATTATAGGAAACTTAACGATATTACTATTGGTGAAACTTACCCCATACCTAACATTGTCGAAATTCTTGACCAATTAGGAAACTCAAAGTACTTCACAACATTAGATCTCGCTTCTGGCTTTCATCAGATAACAATGAATCAAAAAGACGCTTGCAAAACCGCGTTTAGTGTCCCTCAAGGACACTTTGAATTTACAAGGATGCCCTTTGGCCTAAAAAATGCCCCATCAACTTTTCAGCGCTTAATGAACAATGTGCTCACTGGCCTACAAGGTGAGCGCTGTTTTGTGTATTTAGACGATATTGTGTCTTATTCTCATGACCTTAAAACTCACATTGAAAACCTCGGTGCAATATTCGATAGACTACGTAAATTTAACCTAAAATTACAGCCAGACAAATGTGAATTTCTACGAAAAGAAGTCGGCTACCTAGGTCATATAATTAGCGAGGAAGGACTAAAACCAGACCCTAATAAAATAAAATCCGTTAAAGAGTTTCCAATCCCAAAATCCCCCAAGGACATTAAATCCTTTTTAGGACTAATATCATACTATAGACGCTTTATCCCAGAGTTCTCCAAACTATCAAAACCACTCACATCCCTCTTGAAAAAGGATGCATCTTTTCTTTGGACCAACGAACAACAATTAGCTTTCGAAACGCTCAAAGATAAACTCATTACCTCTCCTGTATTAATATACCCAGATTTTACTAAACCATTCAACCTTACTTGCGATGCATCGAACTATGCAATATCAGCTATCCTTTCGCAAGGTCCTATAGGTAAAGACCGCCCTGTAGCCTATGCATCCAGAACACTAAATAAATGTGAAATTAACTATAGCACAACCGAAAAGGAGTTGCTAGCTATAGTTTGGGGCTGCAATTCTTTTAGACCGTATTTATTTGGTCGTAAGTTCATCATAGTAACAGATCATCGTCCACTAAAATGGCTATTTAACCATACTGATCCAAGTAGCAAACTACAACGTTGGCGTCTCCAACTACAAGAATTTGAATACGAAATTATATATAGAAAAGGCAAATTAAATTCAGCAGCTGACGCTCTATCTCGTTATCCCGTTAATCCTGTCTATACCGAAAATCCTGAAAACTTAAATGAAAATGAACTGATTGATCTGGGTCCATTAGACATCAGTCCCTTTAATGACGAAGTCCCTGATTTTACGCCTCTAAGTCCAAGTCCTAACAATTTACCTGATACTCTGCTCCAACCAGAAATTGTACCCGAAATCACTGATCAAAATCCAATAATAGAAAATGAACCCCAACCTTCTAGTAGTCAAGCTCCTATTCTACAACAACCTAATACTTTAATAAGCCCCATAACTTACCTGATCTCGACGACACCTATACTAAATTCTTAA
Protein
MLDQKIIQPSLSPWSSPIWIVPKKTDASGQKKWRIVIDYRKLNDITIGETYPIPNIVEILDQLGNSKYFTTLDLASGFHQITMNQKDACKTAFSVPQGHFEFTRMPFGLKNAPSTFQRLMNNVLTGLQGERCFVYLDDIVSYSHDLKTHIENLGAIFDRLRKFNLKLQPDKCEFLRKEVGYLGHIISEEGLKPDPNKIKSVKEFPIPKSPKDIKSFLGLISYYRRFIPEFSKLSKPLTSLLKKDASFLWTNEQQLAFETLKDKLITSPVLIYPDFTKPFNLTCDASNYAISAILSQGPIGKDRPVAYASRTLNKCEINYSTTEKELLAIVWGCNSFRPYLFGRKFIIVTDHRPLKWLFNHTDPSSKLQRWRLQLQEFEYEIIYRKGKLNSAADALSRYPVNPVYTENPENLNENELIDLGPLDISPFNDEVPDFTPLSPSPNNLPDTLLQPEIVPEITDQNPIIENEPQPSSSQAPILQQPNTLISPITYLISTTPILNS

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Miscellaneous
The open reading frame is located in a copia-like transposable element called 17.6.
Keywords
Aspartyl protease   Endonuclease   Hydrolase   Nuclease   Nucleotidyltransferase   Protease   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Retrovirus-related Pol polyprotein from transposon 17.6
EMBL
DS235852    EEB18765.1    EEB18763.1    GEZM01081533    JAV61609.1    GG694348    + More
EFA13518.1    LBMM01008064    KMQ89174.1    LBMM01013045    KMQ85846.1    NEVH01026087    PNF14896.1    NEVH01002988    PNF41072.1    ABLF02030471    ABLF02066562    GGMR01005468    MBY18087.1    DS497745    EFA13136.1    NEVH01009425    PNF32982.1    NEVH01019964    PNF22169.1    LBMM01022303    KMQ82914.1    NEVH01006666    PNF37360.1    GGMR01006290    MBY18909.1    NEVH01022642    PNF18384.1    GGMR01005970    MBY18589.1    GGMS01012487    MBY81690.1    NEVH01023280    PNF18074.1    GDAI01000738    JAI16865.1    NEVH01005888    PNF38366.1    GDAI01000740    JAI16863.1    NEVH01011195    PNF31840.1    ABLF02041284    M32662    AAA92249.1    LBMM01007099    KMQ90041.1    ABLF02001345    ABLF02006651    ABLF02006655    ABLF02054079    ABLF02054906    ABLF02062695    NEVH01025646    PNF15218.1    ABLF02041728    LBMM01008712    KMQ88680.1    ABLF02024213    ABLF02042472    LBMM01005670    LBMM01005669    KMQ91307.1    KMQ91309.1    GEZM01078735    JAV62639.1    NEVH01000607    PNF43410.1    NEVH01026392    PNF14303.1    DNYX01000282    HBK83635.1    LBMM01019926    KMQ83421.1    NEVH01021952    PNF19057.1    GBHO01004397    JAG39207.1    GBHO01026164    JAG17440.1    GGMR01012631    MBY25250.1    GEDC01017847    GEDC01011974    JAS19451.1    JAS25324.1    AY928610    AAX28844.1    GGMR01003444    MBY16063.1    GANO01002504    JAB57367.1    ABLF02011604    ABLF02041632    GEDC01002915    JAS34383.1    GFXV01006571    MBW18376.1    ABLF02011176    ABLF02041729    GEHC01000906    JAV46739.1    GALX01004629    JAB63837.1    GFTR01008672    JAW07754.1    LBMM01006919    LBMM01006918    KMQ90193.1    KMQ90194.1    GFXV01001507    MBW13312.1    GEHC01000948    JAV46697.1    GEHC01000905    JAV46740.1    GALX01005230    JAB63236.1    AJ000387    CAA04050.1    ABLF02041376    GALX01005891    JAB62575.1    KQ971324    EFA01226.1    GFTR01008505    JAW07921.1    GGMR01006639    MBY19258.1    GBHO01024992    JAG18612.1    GBHO01024993    JAG18611.1    ABLF02012660    ABLF02012662    GGMR01014274    MBY26893.1    AF364550    AAK52058.1    GDHC01015253    JAQ03376.1    GDHF01002622    JAI49692.1    ABLF02041371    AAZX01005108    GEHC01000961    JAV46684.1    AJ009736    CAA08807.1    AF056940    AAC33318.1    ABLF02008732    GDHF01004109    JAI48205.1    GGMS01000510    MBY69713.1    X01472    AAZX01005109    GBHO01007885    JAG35719.1    GDHC01021754    JAP96874.1    ABLF02065961    ABLF02025379    ABLF02025385    ABLF02041365    ABLF02057103    GBRD01016627    JAG49199.1    AF492764    AAM11674.1    GBHO01012506    JAG31098.1    ABLF02035279    ABLF02041373   
Pfam
PF17917   RT_RNaseH        + More
PF00078   RVT_1
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00077   RVP
PF00098   zf-CCHC
PF01661   Macro
PF12259   Baculo_F
PF02902   Peptidase_C48
PF03732   Retrotrans_gag
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR002589   Macro_dom       
IPR018061   Retropepsins       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR022048   Envelope_fusion-like       
IPR003653   Peptidase_C48_C       
IPR038765   Papain-like_cys_pep_sf       
IPR005162   Retrotrans_gag_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF54001   SSF54001       
Gene 3D
PDB
4OL8     E-value=7.118e-65,     Score=628

Ontologies

Topology

Length:
500
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00385
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00177
outside
1  -  500
 
 

Population Genetic Test Statistics

Pi
163.326149
Theta
64.917587
Tajima's D
4.73293
CLR
0
CSRT
0.999950002499875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号