SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10798
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.805
 

Sequence

CDS
ATGGAGTCCACGATCGATCTGTTCGCGGAATTCCTCCGTCTGAGGTACCCGACATTATCGGCCAAATTTTTAGAATTTAAGGCCAATCACGCCGCGAACTCAGAAGCGGTCTCCGTCGCGCCCGCCGCTCCCGTGTCCCCAATACTCGCGAGCAAAGCTCCCGCGTCGATCGCTGCGGTCTCGGTTCCAGCCCTGCGCTCATCCGCAGCACACGTCGCGTCCACGCGTTCATCCGCGGCCTCCATCGCGCCCGCGCCGTCCTCTGCCCCCGAGCGATTGTCCGTGGCCTCCGTCGCGACCGTCAACCCCGCGCCCTCTAAAACGCCCGCCTGCGGGTCGCCCGCGCCCTCCTCTTCATCCGACTCGGAGTCGGACATGGAGGTCGATCTTTCCCCCGCCCCCTCGACTGATGGATTCACAGTAGTCCAAAAAGGTAAGAGGCGCGCTGCGGAAGCCCGAGCTCCCGCGGCCGCCAAAGTAAGCAGAGCCGCGAACGCGTCGCGCCTCCGTCCACCGACCCCCGTTGCTCCCCCTGCCCGTGCTACACCGTCGCCGCGCCCGGTAGTACAAAAGAAAATCCAAGCCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCCTGGGAACGAGTTTCCCTGGCCCTTAAGGCCAAAAATATTAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTTCGTGCCGTCATACGTGGCATCCCTAAAGAGTTGGATGCCGAACTCGTCAAGGCCGACCTTCTGGAACAAGGCCTACCAGTAAATTCAGTGCACCGCATGCACACCGGCCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCCCTCCAGCCTACCCCCGAGGGTAAGCAAATTTTTAACATACGTACCGTCTGTAGGCTCTCCGGTATCGCCGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAACTGTACGGGCATTCTTCCCGTAACTGTCACGCGCGCCCCCGATGCGTCAAGTGTCTAGGCGATCACGCTACGGCCCTTTGCACTCGCGATCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCAAATTACCGCGGATGCCCCCGAGCCCCGAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCCACCCAGACATCAAAGCCTCGGCACCCTCTGTGTCGCAGGCTAAGCCAGCATTCGTTCCGGCGCCGGTGCCCAGTGGCTCGGCCTGGGCGAAACCGCTGCCGTACACGAACACGGCTACACCTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGATACGCCCCTCCCCCGCGAATTGCCCTCCGACAGCGTCCGACAATCTTGCTCTAGCGATCGACTTCTTTCAATCGATTAACTTTGAGCGCGTTAACGCTTTAGGTGACGCCATCCGCGCCGCCTCCACTGCACAGCACTTCATCGCCGTTGTGCAAGAATACGCCGACGTATACGCGTCGTTAAATACGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATCTACTACAGAAGAGCCTTGCACTGCATCCCGCTCGATCCCCCCGCGCTCGTTAACATCGAAGCATCAGTATGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATTGTTCTAAGCAGTGATATCGAGGCGCTGCTCAGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAATTCTCACACCACAACCCCTAATGGCAGGCGGCTCGACGCGCTAGTTGATGATCTCGCCTTCGATATCATCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAGCTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCCCGGACTCTACCCCGTCTCTTCAGGATACCGCTGAAGCCATAGACATCCTAACGTCACACATTACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCGAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCTTCGATCCGCGCCTACGATAGGTATCCTACCATGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCTAGGTGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGTTTAGCTCGTACTCTCAAATCGGATACGGTTGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGTCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGTCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCAATAGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCATCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCAGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTGGGCAAACTGTATGAGCGTTTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCAAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTAGGACTTAACCGACCAAAACCGATCTATACGGGAGCCCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTTTTCAACATGGGCGTACCGGATAGTCTCGTGCTCATCATACGAGACTTCTTGTCTAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTCCCGCAAGGCTCCGTTCTCTCTCCGCTCCTATTTAGTTTATTTATTAACGATATTCCCCGGTCGCCGCCGACTCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAGCTCCAGAGTGCAGCGTTAACCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACACCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGCTAGGAAGGTCAAGTACCTGGGAGTCACCCTGGATGCATCCATGACATTCCGCCCGCATATAAAAACAGTCCGCGATCGTGCCGCATTTATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTCGACCTACACGACGACCTGGGCCTCGAATCGATCCGCAAACACATGAAGTCAGTGTCGGAACGTTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCTGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCAAGTCACCGTCGTCGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACTCTTGCATTAGATACCTTCAGCTCTAACACTAGGAGCAGGCTGAGGAACCCCGGTAACCGTACGCGTCGAACTCGACAAAGAGGTCGACGTGCAGCCTAA
Protein
MESTIDLFAEFLRLRYPTLSAKFLEFKANHAANSEAVSVAPAAPVSPILASKAPASIAAVSVPALRSSAAHVASTRSSAASIAPAPSSAPERLSVASVATVNPAPSKTPACGSPAPSSSSDSESDMEVDLSPAPSTDGFTVVQKGKRRAAEARAPAAAKVSRAANASRLRPPTPVAPPARATPSPRPVVQKKIQAPPPVILQEKAAWERVSLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKQIFNIRTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCTRDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASHPDIKASAPSVSQAKPAFVPAPVPSGSAWAKPLPYTNTATPPSSAIRPAPAIRPSPANCPPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADVYASLNTNDRLTARGGGTVIYYRRALHCIPLDPPALVNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLSMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIIAPLTPTHYPLNIAHRPDILDIALLKNVALRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSTPSLQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFELPDDIRELLRAKNASIRAYDRYPTMENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSIQSADPVHVELVDSEVERRVSLPPSDALPPVTPIEVKDLIKDLRPRKAPGSDGISNRVIKLLPIQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPIYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFINDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALTLGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWARKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKHMKSVSERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITLALDTFSSNTRSRLRNPGNRTRRTRQRGRRAA

Summary

Pfam
PF07530   PRE_C2HC        + More
PF14529   Exo_endo_phos_2
PF00078   RVT_1
PF04937   DUF659
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR006579   Pre_C2HC_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D
PDB
6AR3     E-value=0.0329388,     Score=92

Ontologies

GO

Topology

Length:
1438
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.87667
Exp number, first 60 AAs:
0.00132
Total prob of N-in:
0.00007
outside
1  -  1438
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.746332
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号