SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10774
Annotation
S33901_reverse_transcriptase_-_silkworm_transposon_Pao
Location in the cell
Nuclear   Reliability : 3.145
 

Sequence

CDS
ATGTTAGAAAAACTCACACCAACACTACGTTACCGATACTACGACTTCACCGCGATACAACCGAAGGAGGATCCGGATCTGATTAAATTTGAAAAATTCATGAAAAGAGAAGCCGAACTGTGCAGCCCTTATGCACAGCCTGAACAGGCGGGGCACTACTCGCAGCCCGCACAACATAACAGACGCACACAAAACGTGCACATAGTCAGTGAGAAGCCATCACGAGCTAAATGTCCGTTATGTAGCAACACCGAACACACCACAACAGACTGCTACATATTCAAGAAGGCAGACTCAAACACAAGATGGGACATCGCTAAGAATAAACACCTGTGTTTCCGATGTCTACAGTATAAGAATAAAACCCACAACTGTAAACCGAAGACGTGTGGCATTAATGATTGCAAATATACTCACAACAAGACGCTACACTTCGACAGAAAAATTGAAAAAACAGACAACAGTGACAAGGAAACAACAGAGAACATTAATTCCGCTTGGACCGGAAAACAGAAACAGTCCTATTTGAAAATAATCCCAGTCCAAGTAGAAGGACCAATAAGCACAGTTGATACATACGCGCTGCTTGACGATGGATCAACGGTGACACTCATAGACGAAATCATCTGCAAGAAGACTGGAATAACAGGACCAATCGATCCGTTACACATACAGGCGATTAACAATATAAAATCAACGGAAACAAGGTCAAGAAGAGTCAACCTCACGCTCAGAGGCCTCAACAGTCGAAAAGAAATAATACAAGCGAGAACAGTTAACGACCTACAAGTAACAGCACAAAAAATACCAAAGGAACAGATAGATGAGTATTCGCACCTACGAGACATCAGTGACATCATCACGTACGAGAACGCGAAACCTGGAATACTGATTGGCCAAGACAACTGGCACATGTTACTAGCTTCGAAAGTTAGACGAGGCAACAGGAATCAGCCAATAGCGTCACTGACACCTCTAGGCTGGGTACTGCATGGAGGTCGCACTCGTACCCTAGGCCACCACATAAACTACATAAATCATGCTAGCGAAACCCAGGAAGATGATAAAATAGAAAATCTGGTAAAACAGTATTTCGCTATGGATGCGCTATGCATCACACCAAGAAGACCAAAAACAGACCCAGAGGAACAGGCGCTTCGCATCCTCAACAGCAATACAGTCCACACAACAGATGGAAGATACGAAACTGCTCTGCTCTGGAAAACAGATAATGTCAGTCTACCAGACAACTACAATAACTTGTTAAAGCGACTGATAAATATAGAAAACAAACTTGATCGTAATCCGGAACTGAAACAAAAATACACAGAACAGATGGAACCACTCGTTGCGATAGGCTACGCCGAGCCCGCTCCGAAAATAAAAACAGAGAACAGAACGTGGTACCTACCTCACTTCGCCGTCGTGAACCCCCTGAAGCCGGAAAAACTCCGAGTCGTCCACGACGCCGCCGCCAGAACAAGAGGGGTAGCTTTAAATGATATGCTGCTTAAGGGACCGGACCTACTCCAATCACTACCAGGAGTGATAATGCGATTTAGACAGCATAATATAGCAGTAACAGCAGACATCAAGATGTTCATACAAGTGAAATTGAGACATGAAGACAGAGACGCGCTCCGCTATCTCTGGCGCAAAGATCAGCGAGATGATAAGCCCCCAGAAGAAAAAAGAATGACCTCGTTGATCTTCGGTGCGTCAAGTTCTTTTTCCACAGCGATATCTGTAAAGAGCTTGAACGCCCAGCAACATGCAGCCACGCACCCGGAGGCGGCAGCCGCAACACAGAATAAACACTACGTAGACGACTACTTGAACAGCTTCAAAAGTTTAAAAGTATGCACAACAACAGACTTTCGTCGAAAACACGAAAGAAAGCCGACCTCGAAGACCTTCTGGACCGACAGTAAGATAGTGTTGAGATGGACAAGAACGGGATCACGCTCGTACAAACCATACGTCGCCCAACGCCTGACAGCTATAAAAGACAGTTCAACAGTAAACGGGAGGCGATGGTTACCCACGAAGCACAACGTATCCGACGTCGTGACCCGAGATGTCCCAATGTCGTATCAGAATGAACATAGATGGTTCAGAGGGCCAGATTTCTTACGCCAACGAGAGGACTCCTGGCCGACGGAATCGGCCTCAGAAACAACAGAACCGATGGGTGAAGTAAATATAGCAGCTGCAGCACCGGCGAGAGCCTCATGGCTGAGGCGTCCCGACAACGTGGGGCGCACCGTAGACATAACCGAAGGTGGAGCTCTACGGAGACCGGTACGAAAACTAGTGATCCTGCCCATCGAAGAAGACCATCCTGCACCGAGAAGAATGCGACTGACTCGCACGGCGGGAGTAATGTGCAGGACGAAATAG
Protein
MLEKLTPTLRYRYYDFTAIQPKEDPDLIKFEKFMKREAELCSPYAQPEQAGHYSQPAQHNRRTQNVHIVSEKPSRAKCPLCSNTEHTTTDCYIFKKADSNTRWDIAKNKHLCFRCLQYKNKTHNCKPKTCGINDCKYTHNKTLHFDRKIEKTDNSDKETTENINSAWTGKQKQSYLKIIPVQVEGPISTVDTYALLDDGSTVTLIDEIICKKTGITGPIDPLHIQAINNIKSTETRSRRVNLTLRGLNSRKEIIQARTVNDLQVTAQKIPKEQIDEYSHLRDISDIITYENAKPGILIGQDNWHMLLASKVRRGNRNQPIASLTPLGWVLHGGRTRTLGHHINYINHASETQEDDKIENLVKQYFAMDALCITPRRPKTDPEEQALRILNSNTVHTTDGRYETALLWKTDNVSLPDNYNNLLKRLINIENKLDRNPELKQKYTEQMEPLVAIGYAEPAPKIKTENRTWYLPHFAVVNPLKPEKLRVVHDAAARTRGVALNDMLLKGPDLLQSLPGVIMRFRQHNIAVTADIKMFIQVKLRHEDRDALRYLWRKDQRDDKPPEEKRMTSLIFGASSSFSTAISVKSLNAQQHAATHPEAAAATQNKHYVDDYLNSFKSLKVCTTTDFRRKHERKPTSKTFWTDSKIVLRWTRTGSRSYKPYVAQRLTAIKDSSTVNGRRWLPTKHNVSDVVTRDVPMSYQNEHRWFRGPDFLRQREDSWPTESASETTEPMGEVNIAAAAPARASWLRRPDNVGRTVDITEGGALRRPVRKLVILPIEEDHPAPRRMRLTRTAGVMCRTK

Summary

EMBL
L09635    AAA75005.1    AF530470    AAQ09229.1    RSAL01000375    RVE42106.1    + More
KQ459986    KPJ18861.1    NWSH01005440    PCG64209.1    LNIX01000019    OXA44537.1    JXUM01136032    KQ568367    KXJ69026.1    GEHC01000956    JAV46689.1    LNIX01000004    OXA55241.1    OXA55408.1    GEHC01000967    JAV46678.1    LNIX01000007    OXA52015.1    AAZX01014669    GEZM01052587    JAV74399.1    GEZM01052588    GEZM01052586    JAV74402.1    JAV74401.1    GGFK01009497    MBW42818.1    LNIX01000003    OXA57597.1    GAKP01005125    JAC53827.1    JXUM01109099    KQ565290    KXJ71123.1    GGFL01005193    MBW69371.1    GDHC01018323    JAQ00306.1    GGFK01002635    MBW35956.1    GEHC01000914    JAV46731.1    GGFK01002631    MBW35952.1    GGFK01002641    MBW35962.1    GGFK01002609    MBW35930.1    GGFJ01000302    MBW49443.1    GGFK01002619    MBW35940.1    GGFJ01000218    MBW49359.1    GEHC01000872    JAV46773.1    GAMC01017930    JAB88625.1    GEHC01000947    JAV46698.1    NIRI01000132    RJW72731.1    GGFL01001682    MBW65860.1    GGFK01008809    MBW42130.1    GGFM01007024    MBW27775.1    LN877231    CTR11689.1    GGFL01001842    MBW66020.1    JXUM01111221    KQ565482    KXJ70922.1    GGFL01001727    MBW65905.1    JXUM01034199    KQ561015    KXJ80028.1    GEHC01000945    JAV46700.1    JXUM01005879    KQ560203    KXJ83865.1    AAGJ04115911    GGFJ01000935    MBW50076.1    GGFM01003133    MBW23884.1    GGFJ01000487    MBW49628.1    GGFJ01000432    MBW49573.1    GGFJ01000470    MBW49611.1    GGFJ01000471    MBW49612.1    GGFJ01000333    MBW49474.1    GGFJ01000306    MBW49447.1    LNIX01000027    OXA41945.1    GGFJ01000401    MBW49542.1    GGFJ01000402    MBW49543.1    GDUN01000090    JAN95829.1    ADMH02001934    ETN60411.1    JXUM01038372    KQ561162    KXJ79503.1    BN000804    CAJ00252.1    KL363340    KFD47125.1    AAGJ04043389    GEHC01000921    JAV46724.1    KL596795    KER24838.1    DF142918    GAA48921.1    KL367480    KFD71819.1    OXA56382.1    JXUM01130316    KQ567562    KXJ69370.1    GEHC01000955    JAV46690.1    KL367527    KFD66131.1    JYDK01000005    KRX84552.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00628   PHD
PF00078   RVT_1
PF01425   Amidase
Interpro
IPR005312   DUF1759        + More
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR000253   FHA_dom       
IPR002999   Tudor       
IPR001841   Znf_RING       
IPR000048   IQ_motif_EF-hand-BS       
IPR023631   Amidase_dom       
IPR036928   AS_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57903   SSF57903       
SSF57756   SSF57756       
SSF75304   SSF75304       

Ontologies

Topology

Length:
799
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00199
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00005
outside
1  -  799
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
53.485844
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号