SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10759
Pre Gene Modal
BGIBMGA008421
Annotation
aldehyde_oxidase_AOX1_[Cydia_pomonella]
Location in the cell
Cytoplasmic   Reliability : 1.451
 

Sequence

CDS
ATGGATAAAATTAATTTCACCATCAATGGAGAACAATACAGTTTGTCGGGCGCAGACGTCAGCCCAGTGACGTCACTGAATGACTACATCAGGCATCACCTCCAACTTCATGGTACGAAGGCGATGTGCCACGAGGGCGGCTGTGGGGCATGCGTGGTCTCTGTTCAGCGGACACATCCCACCACCAAAAAGGAGGAAACTCTCGCTGTAAATTCTTGTCTCGTTCACATCCTCTCCTGTCACGAATGGAACATAACGACCGTGGAAGGCGTGGGCAATCGAAGAGACGGCTACCACGCCATACAGGAGCGCCTGGCGATGTTCAACGGGACTCAATGCGGATACTGCACGCCGGGATGGGTCATGAATATGTACAGCTTGTACAAGAGTTCACAGAAAAGCTTAACCACTCAGCAAGTCGAGAATTCATTTGGCAGCAACATATGTCGGTGTACCGGATACAGACCGATTTTGGACGCATTCAAAAGCTTCGCCAACGACACGGAGCCTAGTTCAAAATTACAGGACTTAGAAGATTTACACATAAAGAAATGCATGAATAGTTGTAAACGAAAGTGCAGTATATCGGATGAATGGTGCTTCATAGAGAGACCGTTTCAATCGTTGCTTGAGCTAAGCGTCGCGGGAGGTCGCTGGTACAAAGCTTTTACCGTGCAAGATATATTTAATATTCTGAGGCGTGAAGGAAGTAATAATTACAGACTGGTCGCCGGAAACACGGGGCAAGGAGTTTATCCAATAAAAACGGAGCCAAAGATCTACATAGACATATCGTCGATAGACCGACTGAAGGACGCGCATTCAGACGAGAACTTGAATCTGGGAGCCGGCCTGAGCTTGACCGAAACCATGGATGTCTTTGAAAGGTGGTCTACGAACGAGGAGTACAAATACTTGCTGCAGCTCCGTGAGCATGTGGATTTAGTCGCACACGTGCCTGTACGAAATATCGGCACTCTTGGTGGGAACTTGGCTTTGAAGAACAAGCACAATGAATTCCCTTCAGATATTTTCTTACTGCTGGAAACGATTGGAGCGACTGTCGGAATAATAAAAAGCGATATGAAGATTTCTGATGTGAGCATGTCGCAGTTCCTGAAAATGGATCTCAAAAATAATCTCATAGGCGATGTTAAGCTGCCTCCTTTATCAGCGAATAACCTCTTAAGGACATACAAGATAATGCCGCGAGCCCAGAACGCACACGCCATCGTCAACGCCGGTTTCTTGTTCAAACTGGACCAGGAGAAAAAGGTCGCTGGTTCGAACATAATATACGGAAACATAAGCCCTTCATTCGTTCACGCCACTCAAACGGAGAACAGCTTAATCGGTCTGGAGTTGTTTAAGGACGAGACCTTGTCGAAGGCACTCGAGATACTGGAAAAGGAAATAATTCCTGTTGATTTGCCTCCAGAACCGTCACCGTCCTGTAGGAAGCACCTAGCGCTAGGCTTATTTTATAAGGCCATTCTCTCGTTAGCTCCTGCGGTGAATCCTCGGTACGCGTCAGGCGGGACCACGCTGAAGCGGCTCGTATCGAGGGGAGAGCAGACGTTCGAAACAGATAAATCTTTATGGCCGCTTAACGAGCCAGTGCCGAAACTGGAGGCTCTGACACAGTGCTCCGGTGAGGTGAAGTATGCGTGTGACGTGTACACGGGGCCAAGGACTGTCCATGTCGCCTTCGTGTTATCCGACGTGTGCCTTGGCGAGATTGAAGGCTTCGACGAATCCGAGGCGTTGAAACTCCAAGGCGTGGTCGGATTCTACACCGCCAAAGACATACCCGGCAAGAACGTCTTCACACCGTCAGACGTGCCGTGGCAAGACTTCGCTGAAGAGATCCTGGCTTCGAAGAAAATCTCTTACTACGGGCAGCCCGTCGCTCTCATAGCCGCGACGACACACAGACTAGTGCTCACTGCTGCTAATTTAGTTCGTGTGAAGTACAAGAAATCTAATGCGGTTCCTGTGTTGTCTATTCAAGAAGCATTAGTAGCTGCTGATAAGGAGCAAAGGGTTCGGCAGGAGGTAGCAATCAAAGCGACCAGCAAAGGCTCGGATACCCGACACGTTATAAAGGGTAGTTTCTCGATGCCGTCCCAGTACCACTACACGATGGAGACTCAGTCCTGTACCGTCGCCGTCACGTCGCGCGGGGTGGCCGTGCGCTCCTCCACCCAGTGGATGGACATAGTCCACGTTGCTGTGGCCCAGACACTCGGCATTGATGAAAACAGGGTGGAGGTGTCGGTGCCCCGCGTGGGCGGCGCGTTCGGGGGCAAGGCGTCTCGCGCGGCGCTGGCGGCGTGCGCATGCGCGGTGGTCGCCAGCCGCACGCACCGCGCCGCCTCGCTCGTGATGCCGCTCGGCGACAACATGGCCGCGATCGGGAAGCGTTCGCAATGCGACGCGCGTTACGAGGTCGGCGTGAACGACGAGGGCGTTGTTCAATACGCGAACATCGAATACTACGTGGACTGCGGGTACGCTTACAACGACACTTCCGCCCCGGATGTAGCCTCGATACTGACCAATCTGTACGCGACTGACACTTGGAACATCAACGGATATAGTGTCTTGACGGATAAGCATAGCAACACCTGGTGCAGAGCTCCCGGGACAACGGAAGCCACAGCCATCTTAGAACATTTAATGGAACGAATAGCGCAAGTCACCGGCAAAGATCCTTCCGAAGTCCGAATCTCCAACTTGGCACAGAAACACGAAGCCATCAAGGATATGATCACGGGTTTTAAGCGTGAAGTGGAGTTCGATGACAGAATGGTCCAAATCAAAAAGTTCAATGAGGAGAACGCGTGGCGAAAAAAGGCCTTGAAGCTATCCATCATGTCTTATCCTATAGGCTACTCCTACAACTTCCCCGTTACGATATCAATATACCACGCAGACGGTACTGTGGCCATATCCCACGGGGGTATCGAGATGGGTCAGGGTATCAACACGAAAGTCGCTCAAGTTTGCGCATATAGCTTAAAAATACCCCTAGCTAAGGTCACAGTTAGGGGCAGCAACAGTTTCATCTCACCAAATTCTATGGCTAGCAACGGAAGCATTACTAGTGATTGCGTGGCCTATGCTACTGTGAAGGCTTGTGAGGAGCTGCTGAGCAGGCTACAAGATGCTAAGAAGAATTTGAATGAACCCACTTGGGAGGAAACTATTAAGGCTGCTTATGATAAAGGCGTCAACCTCCAAGCGTCTTATATGACGTCACCCAATGACAATCTAGTGGGCTATGACGTGTACGGAGTCTGCATAGCTGAAGTGGAACTAGACGTGCTGACCGGAAACCACATCCTCACAAGGGTCGATCTGTTGGAAGATACCGGAGTCAGTATTAGTCCTGACATCGACGTGGGACAGATTGAAGGAGCGTTTGTGATGGGTCTCGGTTTGTGGACAACAGAAAGACTGGTCTATGATAAGACAGGGAGACTTCTTACTGACAGGACGTGGACGTACAAGCCCCCGGGTGCTAAGGATATCCCAGTTGACTTCAGGGTTTCGTTCAGGAGAAACGCCCCTAACCCTGCTGGAGTTTTGAGGTCAAAAGCAACCGGTGAACCGGCGTTGGTTTTGGCTGTGGTAGTCATTCACGCATTGCACGAGACCATCGTGGAAGCGAGGAAGGAACACGGGTACCGCGACGTGGAATGGCTACAAGTCGACACACCATACAGCGTGGAGAATATACTAGAAGCGATTTCACCCAGGATAGGAAGCTTTAAATTAACCTGA
Protein
MDKINFTINGEQYSLSGADVSPVTSLNDYIRHHLQLHGTKAMCHEGGCGACVVSVQRTHPTTKKEETLAVNSCLVHILSCHEWNITTVEGVGNRRDGYHAIQERLAMFNGTQCGYCTPGWVMNMYSLYKSSQKSLTTQQVENSFGSNICRCTGYRPILDAFKSFANDTEPSSKLQDLEDLHIKKCMNSCKRKCSISDEWCFIERPFQSLLELSVAGGRWYKAFTVQDIFNILRREGSNNYRLVAGNTGQGVYPIKTEPKIYIDISSIDRLKDAHSDENLNLGAGLSLTETMDVFERWSTNEEYKYLLQLREHVDLVAHVPVRNIGTLGGNLALKNKHNEFPSDIFLLLETIGATVGIIKSDMKISDVSMSQFLKMDLKNNLIGDVKLPPLSANNLLRTYKIMPRAQNAHAIVNAGFLFKLDQEKKVAGSNIIYGNISPSFVHATQTENSLIGLELFKDETLSKALEILEKEIIPVDLPPEPSPSCRKHLALGLFYKAILSLAPAVNPRYASGGTTLKRLVSRGEQTFETDKSLWPLNEPVPKLEALTQCSGEVKYACDVYTGPRTVHVAFVLSDVCLGEIEGFDESEALKLQGVVGFYTAKDIPGKNVFTPSDVPWQDFAEEILASKKISYYGQPVALIAATTHRLVLTAANLVRVKYKKSNAVPVLSIQEALVAADKEQRVRQEVAIKATSKGSDTRHVIKGSFSMPSQYHYTMETQSCTVAVTSRGVAVRSSTQWMDIVHVAVAQTLGIDENRVEVSVPRVGGAFGGKASRAALAACACAVVASRTHRAASLVMPLGDNMAAIGKRSQCDARYEVGVNDEGVVQYANIEYYVDCGYAYNDTSAPDVASILTNLYATDTWNINGYSVLTDKHSNTWCRAPGTTEATAILEHLMERIAQVTGKDPSEVRISNLAQKHEAIKDMITGFKREVEFDDRMVQIKKFNEENAWRKKALKLSIMSYPIGYSYNFPVTISIYHADGTVAISHGGIEMGQGINTKVAQVCAYSLKIPLAKVTVRGSNSFISPNSMASNGSITSDCVAYATVKACEELLSRLQDAKKNLNEPTWEETIKAAYDKGVNLQASYMTSPNDNLVGYDVYGVCIAEVELDVLTGNHILTRVDLLEDTGVSISPDIDVGQIEGAFVMGLGLWTTERLVYDKTGRLLTDRTWTYKPPGAKDIPVDFRVSFRRNAPNPAGVLRSKATGEPALVLAVVVIHALHETIVEARKEHGYRDVEWLQVDTPYSVENILEAISPRIGSFKLT

Summary

Cofactor
FAD
Mo-molybdopterin
[2Fe-2S] cluster
EMBL
BABH01001568    BABH01001569    BABH01001570    BABH01001571    BABH01001572    BABH01001573    + More
ODYU01004253    SOQ43930.1    LC017757    BAR64771.1    KP899546    AKQ06145.1    ODYU01001878    SOQ38698.1    KQ459606    KPI90950.1    NWSH01002143    PCG69059.1    LC017753    BAR64767.1    KF960795    AII21997.1    KF960794    AII21996.1    NWSH01000413    PCG76559.1    EU073424    ABW71272.1    RSAL01000229    RVE43893.1    ODYU01002537    SOQ40155.1    LC017752    BAR64766.1    AGBW02008082    OWR54176.1    KY595779    ARS46833.1    BABH01001657    BABH01001658    BABH01001659    BABH01001660    PCG76558.1    EU073423    ABW71271.1    PCG76561.1    KQ460556    KPJ13979.1    KY595778    ARS46832.1    KQ459193    KPJ03063.1    RSAL01000123    RVE46648.1    KQ982557    KYQ55014.1    KQ459674    KPJ20482.1    KQ979701    KYN19697.1    GL888413    EGI61333.1    KQ434912    KZC11368.1    KQ971466    EFA13012.2    KQ435826    KOX72014.1    KYN19698.1    KQ981281    KYN43332.1    KQ976546    KYM80948.1    KQ414670    KOC64413.1    KYQ55015.1    DS497731    EFA13013.1    KPI90999.1    NWSH01007172    PCG63055.1    ODYU01000376    SOQ35055.1    KZ288369    PBC26783.1    JR045677    AEY60027.1    NWSH01000648    PCG75033.1    GL441193    EFN65044.1    KQ977306    KYN03667.1    KY595781    ARS46835.1    GEDC01004862    JAS32436.1    KC952900    AGQ43599.1    KYN03668.1    LC017754    BAR64768.1    KQ769812    OAD52839.1    GBBI01004413    JAC14299.1    KQ461196    KPJ06614.1    KP859406    AKZ17716.1    AXCN02000553    PCG75032.1    KQ971307    EFA11446.2    NWSH01007964    PCG62737.1    KP859407    AKZ17717.1    PCG62736.1    DS232324    EDS40039.1    KZ150135    PZC72996.1    UFQS01000745    UFQT01000745    SSX06553.1    SSX26900.1    GFDL01004496    JAV30549.1    EDS40041.1    GFDL01008214    JAV26831.1    KF960796    AII21998.1    GFDL01008505    JAV26540.1    ADMH02001746    ETN61219.1    ATLV01024093    KE525349    KFB50588.1    KPI90997.1    GGFM01006571    MBW27322.1    GFDF01002797    JAV11287.1    KP899547    AKQ06146.1    GGFL01002295    MBW66473.1    CH477659    EAT37664.1    EDS40040.1    ETN61221.1    ACPB03000354    ACPB03000355    AAAB01008960    EAA11584.4    EDS40053.1    GBHO01014557    GBHO01014554    GBRD01002756    JAG29047.1    JAG29050.1    JAG63065.1    GDHC01013650    GDHC01001960    JAQ04979.1    JAQ16669.1    GDHC01015520    JAQ03109.1    EAT37662.1    KY643683    AQY62686.1    AXCN02000554    APCN01000032    GGFJ01000686    MBW49827.1    GGFJ01000687    MBW49828.1    APCN01000031    KQ460326    KPJ15694.1   
Pfam
PF01799   Fer2_2        + More
PF00941   FAD_binding_5
PF02738   Ald_Xan_dh_C2
PF01315   Ald_Xan_dh_C
PF03450   CO_deh_flav_C
PF00111   Fer2
PF01130   CD36
PF07651   ANTH
Interpro
IPR036683   CO_DH_flav_C_dom_sf        + More
IPR036856   Ald_Oxase/Xan_DH_a/b_sf       
IPR016166   FAD-bd_PCMH       
IPR002346   Mopterin_DH_FAD-bd       
IPR037165   AldOxase/xan_DH_Mopterin-bd_sf       
IPR000674   Ald_Oxase/Xan_DH_a/b       
IPR016208   Ald_Oxase/xanthine_DH       
IPR002888   2Fe-2S-bd       
IPR036884   2Fe-2S-bd_dom_sf       
IPR005107   CO_DH_flav_C       
IPR008274   AldOxase/xan_DH_Mopterin-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR006058   2Fe2S_fd_BS       
IPR036010   2Fe-2S_ferredoxin-like_sf       
IPR001041   2Fe-2S_ferredoxin-type       
IPR012675   Beta-grasp_dom_sf       
IPR002159   CD36_fam       
IPR013809   ENTH       
IPR008942   ENTH_VHS       
IPR011417   ANTH_dom       
IPR014712   Clathrin_AP_dom2       
SUPFAM
SSF47741   SSF47741        + More
SSF55447   SSF55447       
SSF56176   SSF56176       
SSF56003   SSF56003       
SSF54665   SSF54665       
SSF54292   SSF54292       
SSF48464   SSF48464       
PDB
4YTY     E-value=4.81148e-126,     Score=1160

Ontologies

Topology

Length:
1261
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11721
Exp number, first 60 AAs:
0.00056
Total prob of N-in:
0.00286
outside
1  -  1261
 
 

Population Genetic Test Statistics

Pi
224.107618
Theta
161.829112
Tajima's D
1.143938
CLR
0.559701
CSRT
0.697915104244788
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号