SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10756
Pre Gene Modal
BGIBMGA008418
Annotation
PREDICTED:_indole-3-acetaldehyde_oxidase-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.5
 

Sequence

CDS
ATGCCAAGAGCCCAGAATGCTCATGCGCAAGTGAACACCGGTTTTCTTTATGAATTTAATGCAAAAAATAAAGGTGTAATCGATTCGGCTCGAATAGTGATTGGCGGTTTGTCAGCACATTTCGTTCACGCAAAGCAAACTGAGAAGTACCTCAAAGGGAAAGACGTGTTTACCAATGAAGTTCTGCAGCACGCTCTGATGGTGTTGAAAGGGGAATTAATGGTGGATGAAATTCCGGGAGAAATGAGCCCCGAATTCAGAAAGAAGCTGGCCCTGGGTTTGTTTTACAAAGGACTGTTAAATCTTATTCCGAAGAAAACGATAAACCCTCGTTACCGCTCAGGAGCCAGAGATTTTCGGAAAACTCGTCCACTTTCGAAAGGCTCCGAAGTTTACGATACGAATCCCATAATATGGCCACTGACTGAACCAATGCCGAAGGTCGATGCTCTCGTGCAATGTGCGGGAGAAGCTCAATACGTGAATGACTTACCGAAGCAGACGGCTGAAGTATACTGTGCGTTTGTGACGTCTGATGTCGGAACCGGGGAGATAGTAGAAATCGATCCTACACCTGCTCTTAAAATTCCAGGCGTGCTAGCATTCTTTTCAGCGAAAGACATACCGGGCAAGAATAATTTCTTATCCCAACGAGTACCGACTCAACTGTTCCCCGAAGAGATATTCGCAGAAAAAACGATAAAATATTACGATCAAGCCATAGGTCTGATCGTGGCTGAAACTGAACAGCTGGCAAACAGAGCAGCCCTACTCGTACATGTCAAATACAAAGTGGACAGAAAGCCCATACTAACTATTCACGATGCTAGAGCAAAAGACCCAAGTCGAGTCAAACTTTTCATAATAATTCCTCCTAGAGACAGGGGAACGAATGTGCAGAGGGTCCTCAAAGGCTCAGACACTATTTTAGGCCAATACCACTTTCACATGGAGAACCTATCGTGCGTTACGAGACCAAGCGAAGACGGATTGGATGTATTTGTGGCAACGCAATGGACAGATTCAGTTCACATCGGTATTTCGGAGAGCTTAAACATAGAGCAAAACAGGATTAATCTGACAGTACCTAGATGTGGAGGCGGGTACGGGGCTAAGATATCGCGCGCGTCTCACGTGGCCTGCGCATGCGCCTTGGTCACTCACCTCATGGATAGGCCGTGTCGCTTCGTGATGAGCATTCAGGCTAACCTCAGAGTGATCGGGAAACGACTGCCCAGTCAGAGAGATTTTGAGGTTGGACTCAGTGATTCCGGTGAAATCCAGTATATGGAGTACCAGATATACGAAGATAACGGCTACACCGTGTCGGACGCCGTAATGCCTTTCCTTATCGGGGGGGTCAAGAACTGCTACGATAACAGAAGATGGCAGTCCAAGTTGTTCAATGTGGTTACTGATACCGCGTCGAATATTTATGCGAGAGCACCAGGTTCCCTGGAAGCCATATCCATGGCTGAATATTTAATGGAGCGGATATCGTACGAACTGGAACGTGATCCTATCGAAGTTCGTCTCAATAATCTTGATCCTCAGTACACAGAAGTAGCTGAAGTCGTTCAAACACTCCTGCGAGATAGCGAATACCACAAACGCAAAGAAGAAGTCGAGAAATTTAACAAGGAGAATAGATGGAAGAAACGAGGTCTGAGATTAGCTATGATGAACTGGCCGGCTTCTTCGGTCGTAGACTATCACGTTTTGTTGTCTGTGTACCACGGAGACGGCACGGTCGTGGTCACACATGGCGGTATTGAAATAGGACAAGGGATCAATACAAAAGTCATCCAGGCAGTCGCTTACACACTGAAAATTTCCACTGATAAGGTAATATGTAAACCTCCGACTGTCGCTACGAACCCTAACAACTTCACGACTGGAGGCAGCAGAACCACGCAATCCGTCTGCTTCGGTGCTATTAAATGCTGCCAAATTCTTCTCGACCGCTTGTCAGTTGTTCGGGAGGCCCTAAATGACCCGACCTGGGAAATACTTATCGAAGCCGCGTTCAATAGAGGCATCAATCTGCAGACCAGTTACCGCGTGACGCCAAACGATCAAGATCCGTATAGATGCGCTGGAGCAGCCGTTGCTGAGGTAGAGCTGGATGTCATAACGGGAGAACATGAGATACTGAGAGTTGATATCATTGAAGATGTAGGGACCAGTATCAATCCGGAATTAGATGTCGGACAGGTGGAAGGAGCATTCATGATGGGCGTCGGTTATTGGACCCATGAAGAGTTGATATATGATCAGAAAACTGGAGAGCTGCTCACCGACCGAACTTGGTACTACAAGGTGCCTCTGACTAAGGATATCCCGATAGACTTTAGAATTCAATTCAGGAGGAACTCTTACAACCCAATCGGTACCCTTGGGGCAAGAGCTGTTGCTGAACCTCCGACGTGCTTGTCCATTTGCGTCGCACTAGCCCTGCGGGAAGCTATAGTGTCTTCAAGAGAAGAGACTGGATACCCAAGAAACAAATGGTTCAATGTTGGTAAGCGACTTCTTGTATTCTTATATTAG
Protein
MPRAQNAHAQVNTGFLYEFNAKNKGVIDSARIVIGGLSAHFVHAKQTEKYLKGKDVFTNEVLQHALMVLKGELMVDEIPGEMSPEFRKKLALGLFYKGLLNLIPKKTINPRYRSGARDFRKTRPLSKGSEVYDTNPIIWPLTEPMPKVDALVQCAGEAQYVNDLPKQTAEVYCAFVTSDVGTGEIVEIDPTPALKIPGVLAFFSAKDIPGKNNFLSQRVPTQLFPEEIFAEKTIKYYDQAIGLIVAETEQLANRAALLVHVKYKVDRKPILTIHDARAKDPSRVKLFIIIPPRDRGTNVQRVLKGSDTILGQYHFHMENLSCVTRPSEDGLDVFVATQWTDSVHIGISESLNIEQNRINLTVPRCGGGYGAKISRASHVACACALVTHLMDRPCRFVMSIQANLRVIGKRLPSQRDFEVGLSDSGEIQYMEYQIYEDNGYTVSDAVMPFLIGGVKNCYDNRRWQSKLFNVVTDTASNIYARAPGSLEAISMAEYLMERISYELERDPIEVRLNNLDPQYTEVAEVVQTLLRDSEYHKRKEEVEKFNKENRWKKRGLRLAMMNWPASSVVDYHVLLSVYHGDGTVVVTHGGIEIGQGINTKVIQAVAYTLKISTDKVICKPPTVATNPNNFTTGGSRTTQSVCFGAIKCCQILLDRLSVVREALNDPTWEILIEAAFNRGINLQTSYRVTPNDQDPYRCAGAAVAEVELDVITGEHEILRVDIIEDVGTSINPELDVGQVEGAFMMGVGYWTHEELIYDQKTGELLTDRTWYYKVPLTKDIPIDFRIQFRRNSYNPIGTLGARAVAEPPTCLSICVALALREAIVSSREETGYPRNKWFNVGKRLLVFLY

Summary

Cofactor
FAD
Mo-molybdopterin
[2Fe-2S] cluster
EMBL
BABH01001558    NWSH01007172    PCG63055.1    JTDY01003017    KOB70302.1    ODYU01004588    + More
SOQ44620.1    KQ459674    KPJ20482.1    KQ459193    KPJ03064.1    KQ461154    KPJ08620.1    KPJ03063.1    ODYU01005636    SOQ46683.1    NWSH01000648    PCG75032.1    NWSH01007964    PCG62736.1    ODYU01000376    SOQ35055.1    KY595781    ARS46835.1    KZ150135    PZC72996.1    PZC72997.1    ODYU01001481    SOQ37735.1    RSAL01000123    RVE46648.1    KQ460326    KPJ15694.1    KQ459606    KPI91000.1    PCG62735.1    PCG62737.1    RSAL01000088    RVE48202.1    PCG75033.1    KPI90999.1    ODYU01003306    SOQ41884.1    BABH01034979    BABH01034980    BABH01034981    ODYU01000882    SOQ36316.1    KZ150165    PZC72655.1    KPJ15693.1    LC017753    BAR64767.1    RSAL01000229    RVE43893.1    NWSH01000413    PCG76558.1    KPI90998.1    PZC72656.1    ODYU01002094    SOQ39169.1    BABH01034958    BABH01034959    BABH01034960    BABH01034961    BABH01034962    BABH01034963    BABH01034964    BABH01034965    KPI90997.1    KPI90909.1    KY595779    ARS46833.1    AGBW02008082    OWR54176.1    EU073424    ABW71272.1    KF960795    AII21997.1    AGBW02011403    OWR46707.1    BABH01001657    BABH01001658    BABH01001659    BABH01001660    PCG76560.1    PCG76559.1    GL888413    EGI61333.1    KQ981281    KYN43332.1    KF960794    AII21996.1    ODYU01004253    SOQ43930.1    KQ414670    KOC64413.1    KQ979701    KYN19697.1    ODYU01001878    SOQ38698.1    GL447829    EFN85870.1    KQ976546    KYM80948.1    KQ435826    KOX72014.1    ODYU01002537    SOQ40155.1    JTDY01003126    KOB70107.1    KQ982557    KYQ55014.1    KQ977306    KYN03667.1    PZC72657.1    PCG76561.1    LC017757    BAR64771.1    KY595780    ARS46834.1    NEVH01007404    PNF35793.1    KQ434912    KZC11368.1    KY595778    ARS46832.1    NWSH01002143    PCG69059.1    GL441193    EFN65044.1    GBBI01004413    JAC14299.1    KYN19698.1    LC017758    BAR64772.1    KYN03668.1    LC017752    BAR64766.1    KYQ55015.1    KQ461196    KPJ06614.1    KZ288369    PBC26783.1    JR045677    AEY60027.1    EU073423    ABW71271.1    KK852888    KDR14320.1    CVRI01000075    CRL08602.1    KQ769812    OAD52839.1    GECU01009219    JAS98487.1    GEYN01000003    JAV02126.1    GECL01002669    JAP03455.1    GEDC01004862    JAS32436.1    BABH01001568    BABH01001569    BABH01001570    BABH01001571    BABH01001572    BABH01001573    AGBW02010767    OWR47879.1    ACPB03000354    ACPB03000355    LC017754    BAR64768.1    RVE48204.1    KY643683    AQY62686.1    KP899546    AKQ06145.1    LC017755    BAR64769.1    KP899547    AKQ06146.1    GFDL01004496    JAV30549.1    KQ971307    EFA11446.2    ODYU01001109    SOQ36868.1    KF960796    AII21998.1   
Pfam
PF00941   FAD_binding_5        + More
PF02738   Ald_Xan_dh_C2
PF03450   CO_deh_flav_C
PF01315   Ald_Xan_dh_C
PF00111   Fer2
PF01799   Fer2_2
PF01130   CD36
PF07651   ANTH
Interpro
IPR002346   Mopterin_DH_FAD-bd        + More
IPR037165   AldOxase/xan_DH_Mopterin-bd_sf       
IPR016166   FAD-bd_PCMH       
IPR036856   Ald_Oxase/Xan_DH_a/b_sf       
IPR036683   CO_DH_flav_C_dom_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR036318   FAD-bd_PCMH-like_sf       
IPR005107   CO_DH_flav_C       
IPR008274   AldOxase/xan_DH_Mopterin-bd       
IPR036884   2Fe-2S-bd_dom_sf       
IPR016208   Ald_Oxase/xanthine_DH       
IPR000674   Ald_Oxase/Xan_DH_a/b       
IPR002888   2Fe-2S-bd       
IPR036010   2Fe-2S_ferredoxin-like_sf       
IPR001041   2Fe-2S_ferredoxin-type       
IPR006058   2Fe2S_fd_BS       
IPR012675   Beta-grasp_dom_sf       
IPR002159   CD36_fam       
IPR006621   Nose-resist-to-fluoxetine_N       
IPR013809   ENTH       
IPR008942   ENTH_VHS       
IPR011417   ANTH_dom       
IPR014712   Clathrin_AP_dom2       
SUPFAM
SSF55447   SSF55447        + More
SSF56003   SSF56003       
SSF56176   SSF56176       
SSF47741   SSF47741       
SSF54665   SSF54665       
SSF54292   SSF54292       
SSF48464   SSF48464       
PDB
3UNI     E-value=4.05682e-96,     Score=900

Ontologies

Topology

Length:
849
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0582600000000003
Exp number, first 60 AAs:
0.0437
Total prob of N-in:
0.00268
outside
1  -  849
 
 

Population Genetic Test Statistics

Pi
187.826909
Theta
151.690754
Tajima's D
0.597675
CLR
1.042121
CSRT
0.547722613869307
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号