SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10729
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.997 Nuclear   Reliability : 1.866
 

Sequence

CDS
ATGGAATTGTTTATCCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAAGGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATTCGTTGCATGGGATGATGCTAGGAGACGTTGGGATCCTAACATCTCAGAGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTTATTGCCAGGGCGAAATCGGAGCACGTTGCTAGAATTGGCGAGCGACTGAAGAGCTATCCCTCTGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGTAACTTTTGCAGGTCTAGTCTCCCACCACTACGCAAGTCCGATGACAGTCTGGCCCATAGTGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCTCCGGTGTGATAGTTCCCTGCCGGAGATCTGCTTTACACAGTGTGCAGTCAGGCGGGAACTCCGACTCCTGGACGTCCATAAGTCGAGCGGGCCAGACGGCATCCCTGCAGTGGTTCTGAAAACGTGCGCCCCTGAGCTGACACCTGCGTTAACGCGTTTGTATCGCCTCTCTTATTGCACTAACAGGGTTCCGTCTTCATGGAAGACTGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTATAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATAATTAATATACAACTCCTGAAGTATCTGGAGGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTGTCGAAGCTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGTTAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATTGGGATACTTGGGGTCGATATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTTCATTTGACTCCATACAGAGAAGGGCCGTTCGGATTGTCGATAATCCCGGTCTCACGGATCGTTTGGAACCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCTACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGGTCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGAAACATAACTATGTCGCAATTATCTGCGATTGAGGTTGCTCAAAGAAACCTGGAAGAGTGCTTCACGAAAAGAATGGCCGATCTTGAGGCACAGCCTCATGCTGGAGGGCCTGCGAAGGATACAGTCTCCAAGGTTGCGGAGGAATTCCGAACATTCCGGGAACTTATATTCTCTATGTTGAAACTTCTTCGACAGCAGATTGGTGAGTGCACTCGACTGGTTGATGCGATCGAGACCAGACATCGTCGAAAAAACCTCATCTTTCTGGGAGTCCCTGAAGTTCAAAACGAAGACTGCACCGCTGCCATCTTGGATATTTTGCATAAAAAAATGCTTCTGAATACCTCTGCTGCTGACTTCAATGTGTGTCACCGTATAGGAGCTACTAATAAGGATCATCACCGCCCAATCCTGGTCAGATTGAAATGCTTAGATACACGGATGTCGATTTGGAGGACGAAGTCCAAACTTAAAGGTTCTCCTGTGTCCATCAAGGAATTCCTTACAAAATCTCGACAGGCGGTGTTCGGCAAGAGCCGTCAGTATTTTGGTGTGCGTCAATGTTGGACGCAAGACGGGGTCATTATTATCAAGACTGCGGATGGAAATCGTCACAGATTGACCACTATGGATGAGTTTAGCGACCTCGCAGTTAAATATCCTATTGTGGATGGTAAGCCAACATCAGCTAAGGGCAGCGTCTCTAAGGCGGCACCGGCTATCACTGTGAACTCGAAATTGCGGAAGACCTAG
Protein
MELFIPSSEVPVGGRSRPWYNKASRDAAHLKRSAFVAWDDARRRWDPNISEERRKYNAASRSYKKVIARAKSEHVARIGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDSLAHSAKEKADLLVKLFASNSTVDDGGATPPNILRCDSSLPEICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCTNRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSKWGELNLVQFNPLKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLSFDSIQRRAVRIVDNPGLTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARYRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRRNITMSQLSAIEVAQRNLEECFTKRMADLEAQPHAGGPAKDTVSKVAEEFRTFRELIFSMLKLLRQQIGECTRLVDAIETRHRRKNLIFLGVPEVQNEDCTAAILDILHKKMLLNTSAADFNVCHRIGATNKDHHRPILVRLKCLDTRMSIWRTKSKLKGSPVSIKEFLTKSRQAVFGKSRQYFGVRQCWTQDGVIIIKTADGNRHRLTTMDEFSDLAVKYPIVDGKPTSAKGSVSKAAPAITVNSKLRKT

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=4.04752e-05,     Score=116

Ontologies

Topology

Length:
937
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00042
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  937
 
 

Population Genetic Test Statistics

Pi
17.768219
Theta
14.218725
Tajima's D
0.693173
CLR
1.463144
CSRT
0.577171141442928
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号