SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10718
Pre Gene Modal
BGIBMGA008280
Annotation
Transposon_Ty3-G_Gag-Pol_polyprotein_[Papilio_machaon]
Location in the cell
Cytoplasmic   Reliability : 1.152 Nuclear   Reliability : 1.494
 

Sequence

CDS
ATGAACATAAAATACGGAATACTTTTTGTGGCGCTCTTTGCGGCTGCCTGGGCCCTCCCCAAGCCTGAAGATGACATGTCCATCTTCTACGAGCATGTGGACCGGAACGCTCGTATTGTGGGGGGTAGCCAGGCAGCTCAGGGCAGCCACCCCCATATGGTAGCAATGACTAATGGTATCTTCATCAGGAGCTTTGTCTGCGGAGGCTCAGTGCTCACCGCACGCTCGGTGCTCACCGCTGCTCATTGCATTGTTGCTGTATTCACACTTGGAAGTCTCTCTGGAAATCTTCGTCTGACAGTCGGCACAAACCAATGGAACTCTGGAGGTTCTCTCCACACTGTCTCCAGAAACATCACCCACCCTCACTACGTGTCCAATACCATCAAGAACGACTTGGGTATTCTCATAACTTCCTCGAACATCGTTTTCAATAACCGCGTCAGGCCTATCTCTTTGAGTTTTGACTACGTACCTGGAGGCGTCCCTGTCAGGGTTGCTGGATGGGGAAGAGTTAGGGCTAACGGTGCTCTCTCCACGAATCTTCTGGAGATCAATGTGAGAACCATTGATGGTCAGACTTGCGTGAGGACTGCGGCCCAGGCGGCCATTGACCTTAACGTGAGGGCTCCTCCTGTCGAACCTCATATCGAGCTCTGCACATTCCACGCAGAAGGAACTGGTACTTGCAATGGTGACAGTGGCAGCGCATTGGCTCGGACCGACAGCGGTCTCCAAGTCGGCATCGTGTCGTGGGGCTTCCCTTGCGCACGGGGAGCTCCTGACATCTATGAAGGAGTGACTGAGCCATACTTTTGTGAAAAAGGTATCAAAACATCGGCACAAGTGTATCAAGATACCATTCTTGGGAAGGTAGTGAAGCCCCTTAACAACACCATGTTCAATAATCAAGAATGGTTCTTCCAGCAAGACTCGGCGCCAGCACTTCCGACTCCTGAGGAGACGGATTTATCCATCTTCTTCGAGCACGCCGATCCAAATGCCCGTATCGTCGGAGGGACCGAAGCTGCTCCAGGGAGCCACCCCCACATGGTTTTTCTGACCAGCGGACGAATCAGGAGTTTCATCTGTGGAGGATCGCTGGTGTCGACACGCACCGTACTCACAGCTGGACATTGTGTGGCCGGTGTATATGCGGGCGGAATTTTGCACATCAACCTCCGCGTCACCGTCGGTACGAACGAGTGGAACTCTGGCGGTACCGAATACACCGTGGCCAGAAATATAACACACCCTGACTTTAGCCTCATCTACTTGAAGAACGACATCGGTCTTCTCATAACAGACGAGGAAGTAAAATTATCGGATGCAGTCCGCCCCATCAAATTGAGCTATGATTTCGTGTCTAGTGGAGTTCCCGTTAGAGTTGCTGGATGGGGTAGAATTGGGCATCGTGAGCCGCTTTCCGAAAAGCTTTTGGTGATCGACGTGAGAACAATTGACGGTGAGGCCTGTGTCAGGGCCGCGGCCCAGGCGGCCATAGACTTCAACACGTGGGCCCCCCACGTGGACCCAGCCATTGAACTATGCACCTTCCACGCCAAAGGAACTGGTGCTTGTGGTGGTGACAGTGGTGGTGCATTGACTCGTATCGACAACGGTCTTCAAGTGGGCATGGTATCCTGGGGCTTTTCTTGTGCACGAGGTGCTCCGGATATGTTCGTCAGAATTAGCGCTTTCCGCTCCTGGTTTGATTTTGCTGTGAAATCAACGGAAGATGGAAAATCAAATGTTATATGCATAACTTCAATTGCTACACCTGATGGACAGATTTTTGGGATACCAACCGAATATCAAAATGCCAACTTTCATGAAGAAATTACAAAAACTTCAAATTATGCAAATGGTACAATTGAAGATCTTGAGAGAGACAGGAAATTAGCTTTTGAGAATACAGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAACTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGAAAAGGTTAAAAGCTCAGACAAACCTAAGCTAGCATTTAACGCGAATGTGGTGCCGGAGTTTGACCCTTTATCCAAAGACCAAACTATTATAACATGGATCACCAAAGTAGAAGAATGTGCCGAGATTTATGGGTGGGAAGAAAGAGAAATTATACACTACTCTATGCCAAAATTATGCGGGGTCGCGAAAACATGGTACCAGGGTCTCACTTCGGTATTGCATACGTGGCCTGAATGGAAGAAGAAACTATTAGAATCTTTTCCGTGTAGGGAGGATTACGCTGAGCTTTTAACTGAAATGTTGGCCAAGAAAGTTAAATATGGTGAACCGCTGGAGCATTATTACTACGCGAAGATTAATTTACTAAATACGTGTAACATATCTGGTAAACAAGCCGTAGATTGTCTTCTGTATGGGGTAGAAGATCGCGCAGTAAAAGTTGGAGCTCAAGCAGCTCAATTCCGTGACCCCAAACAGGTACTTAAATATTTCAAAACTGTTAAAATAGGACAGAGCAGAGATAATCAAGATATCATACGCAGAGATACGAATCAGCGGCAACAACTAAAGGGTGTGCTGGAAAGGTATGGTGACCGTTTCTCAAATAGCTTGCATGATTTAGGGTTTACAACGATTACTGAGATGACCATAGAATTAATAGATGACGAACCTATTGTGTATCGCCCGTACCGTATGTCGTACGCCGAAAGACTGATGGATTTGGCATCTGGCTACTATCAGATCCCCATATCGGAAGAGTCTCGACCCAAGACGGCTTTCGTAACACCTGATGGTCAGTTTGAGTTTAACCGCATGCCTTTCGGTCTCGTTAATGCACCTTCAGTATTTCAAAGGACGATAAACAAAATATTGAAGGAAGCAAAAATTAAATATGCCATTGTATACATGGATGATATCCTAATCCCGTCAAAAGACTTCGAGGAAGGGTTGCTGAGATTAGAGGAAGTACTACAACTACTGAAAGAAGACTTCCTCGGATTTGAAGTCAGCGCTGGTGGTATTCGACCTGGGAGTCGAAAAAGTGAAGCAGTCTCCAAGTTTCCACGACCCACGAATCAACACGAGGTACGCCAATTTCTTGGACTGTCCGGTTTCTTTAGACGATTTATACAGGGATACGCCATCATCACTGCTCCCCTAACAGACTTATTAAAAAAGGATGCGGGATGGACCTGGAACGAGGAGCAAGAACAAGCATTCGAAAGGATAAAGGAGTTACTTACAAGCAGACCCATACTTGCTCTGTATGACCCTAAGGCGGAAATAGAACTGCATACCGACGCTTGCAAAGAAGGTCTTGCAGGTATTCTTCTTCAGCGAAACTCAAATGGAGTGATGCAGCCAGTCTCGTATTTTAGCCGGAAAACCACAAGTGACGAACGTAAGATGCATTCATATGAATTAGAAACCCTCGCGGTGATCGCATCTTTGAATCGATTCAGGGTATATCTTTTAGGTATACCATTTAAGATTTTGACTGACTGCAATGCACTTAGGTCTACGTTAGTCAAGAGAGATTTGATACCTCTTATATCACGCTGGTGGGTTCAACTACAGGAATACGACTGCACGATAGAGTACCGTCCTGGCGCACGGATGGCCCATGTAGACGCACTTAGCAGGAATACTGTAGGTAATGATGAAGGTGGAGCGCACATTTTGGATGTCTTGCCTGTAAAAGAACAAGTACAGGCACCGATTCATGACCATGATTGGATTGCGACTGTGCAAGCTGCTGATGAAGAGGTAAGGAGGATTAAACAAAGCTTAGCGGACCCGGTCGTTACGGAAGCCATAGACATACACAAAAATTATAAACTCAAAAACGATAAAGTTTATCGTATCGTAGGAGAAGAGATGAAATGGCTAGTACCTCAAGGTGTAAGGTGGCAGGTTCTAAAAATGAATCATGATGACCTTGGTCATTGGGGATTCGAAAAAACCCTTCAACGCATAAGAGATCATTATTGGTTTCCAAAAATGCGCAGATTTGTAAAAAAGTACGTCACATCATGTCTAGAATGTGCGCACCATAAAGCTCCAGGTGGAAAGCATGAAGGCGAGTTACATCCTATTGAAAAGGTAACTATACCCTTCCACACCGTTCATGTGGATCACCTCGGACCCTTCGTCAAGAGCAAGACAGGTAACTGCTACTTATTGGTAATCGTTGACGGATTCACAAAATATGTGAATATAAACCCGGTCCGGAACACGAAGTCTTTTACCTCAGTACAAGTAATGAAGAGGCATGTAAGCTATTTTGGAGTCCCAACTAGATTAATTACAGATAGGGGTACTAGCTTCACAAGTAAGACATTCCAGGACTTCATTGGATCATACGGTATAAAACATATTCAAAATGCCGTTGCTACTCCTAGGTCCAACGGACAAGTTGAACGATTCAATAGGACAATTTTAGATGCGCTGTCTACGTCTAATCACGGTAGTGACGATAGGTCCTGGGATGAACACATTTTAGACATACAAGTTGGAATCAACACTACAAAACACAAGACAACACAAAAAAGTCCCTCCGAATTACTATTCGGTTTCAACATTATCAGCAGGACCGAAGGTAAGTTGAGCGAAGTCATTATGGAAACACTTAATAGGATTCCGGTAGACGAGTTGGATGAGGTGAGACAGGAAACAGGAGAGAAAATAAAAAAACAACAAGTAAGAGACGCAGACAATTATAACAAACATAGGAAAAGACTAACCCAATATAAAGAGGGAGACCTAGTACGAGTGGCAAGGCAAATGCCTCACGATGGTAAATCACAGAAATTGGTTGTAAAATATCAAGGTCCTTATCGTGTAGTAAAAATGCTCAACAATGATAGGTTTTTAATTGAAGACACACCTCTGACTCGTAAGCACGGCCGACGATACGAAGCTATCGTAGCCATTGATAAAATACAACCGTGGATGAATTTTGAAAGAAATTTTGAATCAGACTGTTCCGATAAAAACGATTCCGAGATAGACGAGGAACGCGAAACAGAAAATTAA
Protein
MNIKYGILFVALFAAAWALPKPEDDMSIFYEHVDRNARIVGGSQAAQGSHPHMVAMTNGIFIRSFVCGGSVLTARSVLTAAHCIVAVFTLGSLSGNLRLTVGTNQWNSGGSLHTVSRNITHPHYVSNTIKNDLGILITSSNIVFNNRVRPISLSFDYVPGGVPVRVAGWGRVRANGALSTNLLEINVRTIDGQTCVRTAAQAAIDLNVRAPPVEPHIELCTFHAEGTGTCNGDSGSALARTDSGLQVGIVSWGFPCARGAPDIYEGVTEPYFCEKGIKTSAQVYQDTILGKVVKPLNNTMFNNQEWFFQQDSAPALPTPEETDLSIFFEHADPNARIVGGTEAAPGSHPHMVFLTSGRIRSFICGGSLVSTRTVLTAGHCVAGVYAGGILHINLRVTVGTNEWNSGGTEYTVARNITHPDFSLIYLKNDIGLLITDEEVKLSDAVRPIKLSYDFVSSGVPVRVAGWGRIGHREPLSEKLLVIDVRTIDGEACVRAAAQAAIDFNTWAPHVDPAIELCTFHAKGTGACGGDSGGALTRIDNGLQVGMVSWGFSCARGAPDMFVRISAFRSWFDFAVKSTEDGKSNVICITSIATPDGQIFGIPTEYQNANFHEEITKTSNYANGTIEDLERDRKLAFENTETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPEKVKSSDKPKLAFNANVVPEFDPLSKDQTIITWITKVEECAEIYGWEEREIIHYSMPKLCGVAKTWYQGLTSVLHTWPEWKKKLLESFPCREDYAELLTEMLAKKVKYGEPLEHYYYAKINLLNTCNISGKQAVDCLLYGVEDRAVKVGAQAAQFRDPKQVLKYFKTVKIGQSRDNQDIIRRDTNQRQQLKGVLERYGDRFSNSLHDLGFTTITEMTIELIDDEPIVYRPYRMSYAERLMDLASGYYQIPISEESRPKTAFVTPDGQFEFNRMPFGLVNAPSVFQRTINKILKEAKIKYAIVYMDDILIPSKDFEEGLLRLEEVLQLLKEDFLGFEVSAGGIRPGSRKSEAVSKFPRPTNQHEVRQFLGLSGFFRRFIQGYAIITAPLTDLLKKDAGWTWNEEQEQAFERIKELLTSRPILALYDPKAEIELHTDACKEGLAGILLQRNSNGVMQPVSYFSRKTTSDERKMHSYELETLAVIASLNRFRVYLLGIPFKILTDCNALRSTLVKRDLIPLISRWWVQLQEYDCTIEYRPGARMAHVDALSRNTVGNDEGGAHILDVLPVKEQVQAPIHDHDWIATVQAADEEVRRIKQSLADPVVTEAIDIHKNYKLKNDKVYRIVGEEMKWLVPQGVRWQVLKMNHDDLGHWGFEKTLQRIRDHYWFPKMRRFVKKYVTSCLECAHHKAPGGKHEGELHPIEKVTIPFHTVHVDHLGPFVKSKTGNCYLLVIVDGFTKYVNINPVRNTKSFTSVQVMKRHVSYFGVPTRLITDRGTSFTSKTFQDFIGSYGIKHIQNAVATPRSNGQVERFNRTILDALSTSNHGSDDRSWDEHILDIQVGINTTKHKTTQKSPSELLFGFNIISRTEGKLSEVIMETLNRIPVDELDEVRQETGEKIKKQQVRDADNYNKHRKRLTQYKEGDLVRVARQMPHDGKSQKLVVKYQGPYRVVKMLNNDRFLIEDTPLTRKHGRRYEAIVAIDKIQPWMNFERNFESDCSDKNDSEIDEERETEN

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=4.77554e-46,     Score=472

Ontologies

Topology

SignalP
Position:   1 - 18,         Likelihood:  0.995905
 
 
Length:
2312
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.9291799999999
Exp number, first 60 AAs:
7.30907
Total prob of N-in:
0.44218
outside
1  -  2312
 
 

Population Genetic Test Statistics

Pi
253.95346
Theta
168.853142
Tajima's D
1.568835
CLR
0.364647
CSRT
0.802909854507275
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号