SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10708
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.112
 

Sequence

CDS
ATGGAAGAAGAAGATAACCCCGCGTTGTTCGCGAAATTCGTTCGAGAGTACTGCCCGGACATTATGTCGAAGTTTAGGGCGTACAAAGCTAGCCTAGTAGCCGCGACTATCCCCGACTCACCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCTTGCGCGGCATCAAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTTCGAGTCGGCCGCCAGCCCCGAACCCGGAACCTCCGATGGGTTCACCACCGTCGCGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAGCCAAAGGCCGCGAACGCGTCGCGTCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGACCCCAACCCGCGTCCGTCCGCAAAATTCCCGCGCCGCCGCCGGTAATTTTGCAAGATAAGGCCGCGTGGGATCGCGTATCCCGTGCCTGTAAGGCACAAAACGTAAACGTCATCCATGCGCGTAACATCGCGCACGGCATTCAAATAAAAACGGCCTCACCGGACGACCACAGGGCGCTGACAGCCCACCTCCGAAAGGAACGCATAAGCTTCCACACTTATGCGCTCCAGGAGGATCGCGAGCTCCGCGTAGTAATACGCGGAGTACCGAAGGAGCTCGACGTCGAGCTGGTCAAGGAGGACCTCATCGGGCAGGCGTACCCGATTGTAAGCGTGCACCGAATGCACAGCGGGCGCGATAAATTCGCATATAATATGGTTCTCGTCGCGTTAGAACCAACCGCCGAAGGCAAACGGATTGCCTCAAGCCTCCGCACCGTTTGCGGCTTATCCGGGGTCACCGTCGAGGCCCCATATAAAAAAGGCACTCCCGGGCAGTGCCACCGCTGTCAGTTATACGGCCACTCCGCGCGCAACTGCCACGCGCGCCCGCGGTGCGTAAAGTGCCTCGGCGACCACGCGACAGCCGACTGTTCGCGGGTCAAAGAGACAGCGACTGAACCACCGAGCTGTGTGCTCTGCCAGAAGCAGGGCCACACAGCCAACTACCGCGGATGCCCCAAGGCCCCGCGGAAGCGTCTGGCCAACGCGCCTCCAAAAACCGTCGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCTGCCTTCGTGCCGGCACCGCGCGATCAAGTATATGAGTTTCTCCGCGATAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAACTACGTCATGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAGTATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCGAACTTAGGGACCTATTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTACGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCTAAACACGTCATCTCGGATCCTCCTGATCCACTAACGGTGCTTTTAGTTGAAAATCGTTAA
Protein
MEEEDNPALFAKFVREYCPDIMSKFRAYKASLVAATIPDSPMSPPTPAPASIASCAASSSGSDSESEMEFESAASPEPGTSDGFTTVARGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPQPASVRKIPAPPPVILQDKAAWDRVSRACKAQNVNVIHARNIAHGIQIKTASPDDHRALTAHLRKERISFHTYALQEDRELRVVIRGVPKELDVELVKEDLIGQAYPIVSVHRMHSGRDKFAYNMVLVALEPTAEGKRIASSLRTVCGLSGVTVEAPYKKGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATADCSRVKETATEPPSCVLCQKQGHTANYRGCPKAPRKRLANAPPKTVGPKTSAPRAPKPAFVPAPRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPNLGTYYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMYDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLVENR

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000967001,     Score=105

Ontologies

Topology

Length:
1265
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.36968
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00001
outside
1  -  1265
 
 

Population Genetic Test Statistics

Pi
104.795547
Theta
117.49708
Tajima's D
0.056354
CLR
16.705352
CSRT
0.391330433478326
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号