SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10707
Annotation
PREDICTED:_uncharacterized_protein_LOC107191251_[Dufourea_novaeangliae]
Location in the cell
Cytoplasmic   Reliability : 1.457 Mitochondrial   Reliability : 1.024 Nuclear   Reliability : 1.452
 

Sequence

CDS
ATGGATTTACCTATCTTACAAGAGCTTCTGAAGGCCATCAAAGACGCAGTTTCCGGTTCCCGCCAGAACGACAGCGAGGTCGCCCTGCCCGTATTTGATCCTGCTAAAAGTGACCTTGGTGCTGAATCATGGTGCAACAATATTGAAACCCTCTCCAAAGAGTTTGGATGGAGTAACATCGCAACAGTCGCCAAAGCTGGTAAGGCCCTTAAGGGATCCGCCTTATTGTGGTTTGAAACATGGGACCCGGCTGAGGGTCGTTCGTGGGACAATTTACGTTTAGAGCTGGTAGCTTTATACCCTGAGAAAAAGAATCTAGCAGAAAAACTTCATAAGGCAGTACTATACACGTCGGAAACTGCAGATTCTTATTGCGAGTACGCAAGGGAAAAAATTAGTATAATGGAACTCTCAGGTGCGATAAACAGTCTAGATCATCAGCTGCAGGATAGGATAAGGGCTATTTTTCAAAAATACCCCTCTGTTTTGGACAATATTGGTCATGTAAAGACTGGTGAACTTGAAATAAAATTAAAAAGAGATGAGGTAATCTATTACAGGCCATACCGATTAGCCCCGATAGAAAGAGAGAAGGTTAAAGAATTAGTGGAAGATTTATTGAATAAAAAAATAATCAAAGAAAGTAATTCATCTTTCGCTAGTCCCATGATTTTAGTTAAAAAAAAAGATGGAAGCGATAGAATGTGCATTGATTATAGAGCGTTAAATAAGATAATAGAAAAGGATCGATATCCTCTCCCGCTCATTGAAGATCAAATAGATAAATTGGGAAATTCAACGTATTATATATCCATAGATATGAAAAATGGCTTTTATCAAATCCCTATTTCCAGTAACTCCACTAAATACACCGCCTTTGTAACACCAGACGGACATTACGAATTTACGAAAATGCCTTTTGGAATTTGTAATGGCCCGTCGGTGTTTCAAAGAGCTATCACTAAGGCAGTAGGCCATTTACCATTTCTTTTGGTGTATATTGATGACATTTTGATCCCGTTTAATACAATTGAAGAAGGTTTATCTTATTTGGAACAAACAATTTCGGCACTTAGCTCTTGTGGCTTTACAGTTAATCTTAAGAAATGCAAATTCTTCCTAGATAGCATCGAGTATTTGGGGAGACGAATATCTCGTGAAGGTGTTAGGCCGGGTGAATCTAAAACCAATGCTTTAGCAAATTCACCAACACCCTCTAATGTTAAACAAGTCCGACAATTTATGGGCTTATGTAGTTATTTTAGGAAATTTATACCCGATTTTGCCTCGAAGACAGCATGTATAACAAAATTGACTAGAAACAACGAAAAATGGGAATGGGGCATTGAACAAGATAGAGCACGAAAGTATGTAATTGATCGTCTTACCTCCAAACCTCTTTTGACAATATTTGACCCTCAGCGTCCAACAGAGTTACACACCGATGCTAGTGCTATAGGGATAACATCTTTTATCAAAAAATATATTAACCATTGTCTTACTTGCGTTAAGAAAAAGGGAGTCTCTGGTCCTAAACAAGGGTTATTACATCCGATCGATAAAGTTGCTGTACCATTCCATACCATACATTTAGATTGCACAGGGCCTTTTCCAACAACCACGGAAGGCTTTAAGCACATACTATTATTAGTTGATGGTTTCACAAAATTTTGTCTCTTAAAACCCCTTAAAACACTAATTGCGGGAGAATTAATACCAATTATCCGAGAAACTGTTACACTATTTGGTACACCATCATTGGTAATAACTGATCGTGGTACGAATTTTAGCTCTAATCAAATCAAAGACCTTTTTAGAGAACTGAATATCGAACACCACATGATAGCTACTGGTACACCTCGAGGCAATGGTCAGGTTGAGCGTTATGTGGCTACTGTAGTCAATATGTTAAACACTATGTGCGAGGAGCCGTCAGAGTGGCCGAACGTATTGCCAAAAGTACAGCAGTCAATTAACACGACAGTACAAAAATCGACTGGTTTCACCCCCTTACGTTTACTAACCGGTATAGAAGCAAATATACCTATAGTACAATCTCATCTAAACGGAATTATTAATGATGAGGATTTACACCCCAATATTGACGTCCAAGCTGATCGTGAAATAGCCAAACAGAGACTACAAAAAATAGCAGAAACATTTAAACAACGATTTGATCATGTTAGGCGGAATAATAAACAATACAATATAGGTGATTTGGTCTATGTCAGCCAAGATCATAGGCGTAATGATAAATTAAGATCTAGATTTAAGGGCCCTTACGAAATTCAGTCTATCCTTCCAAATGATCGCTATACTCTGAAAGGCAACGGTAATGTTAGGAATATAGTTGTCGCTAAGGAAAAATTACGGTTTTGGCCAGGAGAATGGGTTGATGATAATTTGTGA
Protein
MDLPILQELLKAIKDAVSGSRQNDSEVALPVFDPAKSDLGAESWCNNIETLSKEFGWSNIATVAKAGKALKGSALLWFETWDPAEGRSWDNLRLELVALYPEKKNLAEKLHKAVLYTSETADSYCEYAREKISIMELSGAINSLDHQLQDRIRAIFQKYPSVLDNIGHVKTGELEIKLKRDEVIYYRPYRLAPIEREKVKELVEDLLNKKIIKESNSSFASPMILVKKKDGSDRMCIDYRALNKIIEKDRYPLPLIEDQIDKLGNSTYYISIDMKNGFYQIPISSNSTKYTAFVTPDGHYEFTKMPFGICNGPSVFQRAITKAVGHLPFLLVYIDDILIPFNTIEEGLSYLEQTISALSSCGFTVNLKKCKFFLDSIEYLGRRISREGVRPGESKTNALANSPTPSNVKQVRQFMGLCSYFRKFIPDFASKTACITKLTRNNEKWEWGIEQDRARKYVIDRLTSKPLLTIFDPQRPTELHTDASAIGITSFIKKYINHCLTCVKKKGVSGPKQGLLHPIDKVAVPFHTIHLDCTGPFPTTTEGFKHILLLVDGFTKFCLLKPLKTLIAGELIPIIRETVTLFGTPSLVITDRGTNFSSNQIKDLFRELNIEHHMIATGTPRGNGQVERYVATVVNMLNTMCEEPSEWPNVLPKVQQSINTTVQKSTGFTPLRLLTGIEANIPIVQSHLNGIINDEDLHPNIDVQADREIAKQRLQKIAETFKQRFDHVRRNNKQYNIGDLVYVSQDHRRNDKLRSRFKGPYEIQSILPNDRYTLKGNGNVRNIVVAKEKLRFWPGEWVDDNL

Summary

Pfam
PF00078   RVT_1        + More
PF00665   rve
PF03732   Retrotrans_gag
PF00098   zf-CCHC
Interpro
IPR036397   RNaseH_sf        + More
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
IPR005162   Retrotrans_gag_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.40015e-56,     Score=559

Ontologies

Topology

Length:
802
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00312
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  802
 
 

Population Genetic Test Statistics

Pi
37.371129
Theta
59.745242
Tajima's D
-1.333909
CLR
0.072315
CSRT
0.0789960501974901
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号